\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623300018:

Variant ID: vg0623300018 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23300018
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CTCATAAGTCCATGTACTTACAGAACCGTCGGGTCCGAAGCTCAGCTGTGTTTGCCTTGCTCCTGCCGGTGCTTTATCCTTGAGGTGCGTCAAATAATAC[C/T]
GTTTGAGATGTCCTGTTCCTGAACTAGAAGATGCAGACAAAGTTTTTCCACAATGTTGTAGTCCACCATTACCCTGATTTTTTCGAAGTGCCGCCAACAC

Reverse complement sequence

GTGTTGGCGGCACTTCGAAAAAATCAGGGTAATGGTGGACTACAACATTGTGGAAAAACTTTGTCTGCATCTTCTAGTTCAGGAACAGGACATCTCAAAC[G/A]
GTATTATTTGACGCACCTCAAGGATAAAGCACCGGCAGGAGCAAGGCAAACACAGCTGAGCTTCGGACCCGACGGTTCTGTAAGTACATGGACTTATGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.20% 0.28% 0.15% NA
All Indica  2759 58.20% 41.20% 0.40% 0.22% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 66.90% 32.70% 0.00% 0.37% NA
Indica I  595 19.00% 80.70% 0.17% 0.17% NA
Indica II  465 92.90% 6.70% 0.43% 0.00% NA
Indica III  913 59.30% 39.90% 0.55% 0.33% NA
Indica Intermediate  786 66.20% 33.20% 0.38% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623300018 C -> T LOC_Os06g39250.1 missense_variant&splice_region_variant ; p.Asp125Asn; MODERATE nonsynonymous_codon ; D125N Average:67.343; most accessible tissue: Zhenshan97 panicle, score: 89.389 unknown unknown TOLERATED 0.46
vg0623300018 C -> DEL LOC_Os06g39250.1 N frameshift_variant Average:67.343; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623300018 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623300018 NA 5.15E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 7.13E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 4.35E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 8.80E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 4.89E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 4.22E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 4.95E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 1.21E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 3.71E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 1.18E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 1.49E-08 NA mr1659 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 8.56E-09 9.07E-12 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 2.08E-08 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 9.53E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 7.11E-09 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623300018 NA 1.05E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251