Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623294372:

Variant ID: vg0623294372 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23294372
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AAACAAACTGTTGGCGACCGGCCCACCAAGCCCAGGAAACTTGGCGGTTACTCCTCTACTCCCTCCGTCCTTTAAAAAACGAACCTATCACCGAATGTGA[C/T]
ATATTCTAATATAATAAATCTGAACATATGTATATTTAGATTCGTAATACTAGGATGTGTCATATCTGATACTAGATTAGTTTTTTATGGGACGGAGGAA

Reverse complement sequence

TTCCTCCGTCCCATAAAAAACTAATCTAGTATCAGATATGACACATCCTAGTATTACGAATCTAAATATACATATGTTCAGATTTATTATATTAGAATAT[G/A]
TCACATTCGGTGATAGGTTCGTTTTTTAAAGGACGGAGGGAGTAGAGGAGTAACCGCCAAGTTTCCTGGGCTTGGTGGGCCGGTCGCCAACAGTTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.30% 0.25% 0.00% NA
All Indica  2759 46.00% 53.60% 0.40% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 34.90% 64.70% 0.37% 0.00% NA
Indica I  595 84.40% 15.50% 0.17% 0.00% NA
Indica II  465 14.00% 86.00% 0.00% 0.00% NA
Indica III  913 43.20% 56.10% 0.77% 0.00% NA
Indica Intermediate  786 39.30% 60.30% 0.38% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623294372 C -> T LOC_Os06g39240.1 upstream_gene_variant ; 299.0bp to feature; MODIFIER silent_mutation Average:93.925; most accessible tissue: Minghui63 panicle, score: 97.406 N N N N
vg0623294372 C -> T LOC_Os06g39240.2 upstream_gene_variant ; 294.0bp to feature; MODIFIER silent_mutation Average:93.925; most accessible tissue: Minghui63 panicle, score: 97.406 N N N N
vg0623294372 C -> T LOC_Os06g39230.1 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:93.925; most accessible tissue: Minghui63 panicle, score: 97.406 N N N N
vg0623294372 C -> T LOC_Os06g39250.1 downstream_gene_variant ; 2266.0bp to feature; MODIFIER silent_mutation Average:93.925; most accessible tissue: Minghui63 panicle, score: 97.406 N N N N
vg0623294372 C -> T LOC_Os06g39240-LOC_Os06g39250 intergenic_region ; MODIFIER silent_mutation Average:93.925; most accessible tissue: Minghui63 panicle, score: 97.406 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623294372 C T -0.11 -0.13 -0.1 -0.07 -0.09 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623294372 NA 1.49E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 2.00E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 1.91E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 3.01E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 2.30E-10 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 1.03E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 7.46E-08 3.11E-16 mr1659 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 5.48E-08 2.41E-11 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 5.73E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 8.15E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 4.55E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 3.31E-12 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623294372 NA 3.40E-09 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251