\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623254583:

Variant ID: vg0623254583 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23254583
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTCAAGACCGCTGCATTACTCGAGCAGCGCGCGAATCGGGACAAGCCGGTTCGTTTCGCCTGGAGACATGATGATGGCGCTCTTCTCGGTTGGCGA[A/G]
CGCAGTTAATGCGCGCACGATCTGCCCCATCTCAACCGTCACGGCCGCACATCTGCCGCGTGCGCCGCAAACGGGCGAGTGGGGTTAGTGGAGGCGTGGG

Reverse complement sequence

CCCACGCCTCCACTAACCCCACTCGCCCGTTTGCGGCGCACGCGGCAGATGTGCGGCCGTGACGGTTGAGATGGGGCAGATCGTGCGCGCATTAACTGCG[T/C]
TCGCCAACCGAGAAGAGCGCCATCATCATGTCTCCAGGCGAAACGAACCGGCTTGTCCCGATTCGCGCGCTGCTCGAGTAATGCAGCGGTCTTGAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 0.30% 3.00% 39.61% NA
All Indica  2759 47.20% 0.10% 2.75% 49.98% NA
All Japonica  1512 72.60% 0.40% 1.79% 25.26% NA
Aus  269 58.70% 1.10% 13.75% 26.39% NA
Indica I  595 45.20% 0.00% 2.52% 52.27% NA
Indica II  465 36.80% 0.00% 2.37% 60.86% NA
Indica III  913 56.70% 0.20% 3.07% 39.98% NA
Indica Intermediate  786 43.60% 0.10% 2.80% 53.44% NA
Temperate Japonica  767 65.70% 0.00% 0.39% 33.90% NA
Tropical Japonica  504 81.90% 1.00% 3.77% 13.29% NA
Japonica Intermediate  241 74.70% 0.40% 2.07% 22.82% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 62.20% 0.00% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623254583 A -> G LOC_Os06g39170.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0623254583 A -> G LOC_Os06g39160.1 downstream_gene_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0623254583 A -> G LOC_Os06g39180.1 downstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0623254583 A -> G LOC_Os06g39160-LOC_Os06g39170 intergenic_region ; MODIFIER silent_mutation Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg0623254583 A -> DEL N N silent_mutation Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623254583 7.76E-07 2.68E-07 mr1219 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623254583 8.78E-06 1.11E-06 mr1219_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251