\
| Variant ID: vg0623254583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 23254583 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTCTTCAAGACCGCTGCATTACTCGAGCAGCGCGCGAATCGGGACAAGCCGGTTCGTTTCGCCTGGAGACATGATGATGGCGCTCTTCTCGGTTGGCGA[A/G]
CGCAGTTAATGCGCGCACGATCTGCCCCATCTCAACCGTCACGGCCGCACATCTGCCGCGTGCGCCGCAAACGGGCGAGTGGGGTTAGTGGAGGCGTGGG
CCCACGCCTCCACTAACCCCACTCGCCCGTTTGCGGCGCACGCGGCAGATGTGCGGCCGTGACGGTTGAGATGGGGCAGATCGTGCGCGCATTAACTGCG[T/C]
TCGCCAACCGAGAAGAGCGCCATCATCATGTCTCCAGGCGAAACGAACCGGCTTGTCCCGATTCGCGCGCTGCTCGAGTAATGCAGCGGTCTTGAAGAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.10% | 0.30% | 3.00% | 39.61% | NA |
| All Indica | 2759 | 47.20% | 0.10% | 2.75% | 49.98% | NA |
| All Japonica | 1512 | 72.60% | 0.40% | 1.79% | 25.26% | NA |
| Aus | 269 | 58.70% | 1.10% | 13.75% | 26.39% | NA |
| Indica I | 595 | 45.20% | 0.00% | 2.52% | 52.27% | NA |
| Indica II | 465 | 36.80% | 0.00% | 2.37% | 60.86% | NA |
| Indica III | 913 | 56.70% | 0.20% | 3.07% | 39.98% | NA |
| Indica Intermediate | 786 | 43.60% | 0.10% | 2.80% | 53.44% | NA |
| Temperate Japonica | 767 | 65.70% | 0.00% | 0.39% | 33.90% | NA |
| Tropical Japonica | 504 | 81.90% | 1.00% | 3.77% | 13.29% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.40% | 2.07% | 22.82% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 62.20% | 0.00% | 2.22% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623254583 | A -> G | LOC_Os06g39170.1 | upstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0623254583 | A -> G | LOC_Os06g39160.1 | downstream_gene_variant ; 1448.0bp to feature; MODIFIER | silent_mutation | Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0623254583 | A -> G | LOC_Os06g39180.1 | downstream_gene_variant ; 4172.0bp to feature; MODIFIER | silent_mutation | Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0623254583 | A -> G | LOC_Os06g39160-LOC_Os06g39170 | intergenic_region ; MODIFIER | silent_mutation | Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| vg0623254583 | A -> DEL | N | N | silent_mutation | Average:42.39; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623254583 | 7.76E-07 | 2.68E-07 | mr1219 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623254583 | 8.78E-06 | 1.11E-06 | mr1219_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |