\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623248264:

Variant ID: vg0623248264 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23248264
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGGGCCAAACGGGGGAAGGCAAAGATGGTGATAAGGGAGTTATGTTTCCTTATGACTATCCAACTACATCTACATTTTATGTGAGTACCTATAGCGG[C/T]
AAAGCTCCGTATTTCAATGGTACGGACTATGCCGCTTGGAAGCATAAGATGAAGATGCATTTGAAGTTTATTAACCCATCTATTTGGAGAATAGTCAAAA

Reverse complement sequence

TTTTGACTATTCTCCAAATAGATGGGTTAATAAACTTCAAATGCATCTTCATCTTATGCTTCCAAGCGGCATAGTCCGTACCATTGAAATACGGAGCTTT[G/A]
CCGCTATAGGTACTCACATAAAATGTAGATGTAGTTGGATAGTCATAAGGAAACATAACTCCCTTATCACCATCTTTGCCTTCCCCCGTTTGGCCCGACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.10% 0.72% 0.04% NA
All Indica  2759 96.20% 2.80% 0.91% 0.04% NA
All Japonica  1512 31.20% 68.30% 0.40% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 0.80% 1.51% 0.00% NA
Indica II  465 94.20% 5.40% 0.43% 0.00% NA
Indica III  913 97.40% 1.30% 1.20% 0.11% NA
Indica Intermediate  786 95.00% 4.60% 0.38% 0.00% NA
Temperate Japonica  767 51.40% 47.80% 0.78% 0.00% NA
Tropical Japonica  504 5.40% 94.40% 0.00% 0.20% NA
Japonica Intermediate  241 21.20% 78.80% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 89.60% 1.04% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623248264 C -> T LOC_Os06g39150.1 synonymous_variant ; p.Gly34Gly; LOW synonymous_codon Average:11.502; most accessible tissue: Callus, score: 26.325 N N N N
vg0623248264 C -> DEL LOC_Os06g39150.1 N frameshift_variant Average:11.502; most accessible tissue: Callus, score: 26.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623248264 NA 2.41E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 5.96E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 2.65E-06 4.70E-17 mr1097 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 9.74E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 1.95E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 1.92E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 8.19E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 2.43E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 6.60E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 7.01E-10 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 2.23E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 9.11E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 4.12E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 5.61E-08 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 1.94E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 4.33E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 6.37E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 1.18E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 2.14E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 3.20E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 3.20E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 2.89E-07 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 2.59E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 3.41E-08 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 1.18E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 3.92E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 4.19E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623248264 NA 3.14E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251