\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623234685:

Variant ID: vg0623234685 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23234685
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGAAGGTGATGTACAGCAACATGGTCGACGCCGACGTGGCGGCGGTGAGAGGTTCCTTCCTGAGGTCTACCGCATCGACCACATCGACACCAACAGG[C/A]
AGATCCTCAACTGGTGCGACCGGCTATACCTCCAGGTCTAGCCAGAGGAGGAACGTCGGCTGGATTTCTAGCCAGAACACCTGCTAGCGCTCCGAGGACT

Reverse complement sequence

AGTCCTCGGAGCGCTAGCAGGTGTTCTGGCTAGAAATCCAGCCGACGTTCCTCCTCTGGCTAGACCTGGAGGTATAGCCGGTCGCACCAGTTGAGGATCT[G/T]
CCTGTTGGTGTCGATGTGGTCGATGCGGTAGACCTCAGGAAGGAACCTCTCACCGCCGCCACGTCGGCGTCGACCATGTTGCTGTACATCACCTTCTCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.50% 0.06% 0.28% NA
All Indica  2759 58.00% 41.50% 0.07% 0.40% NA
All Japonica  1512 99.50% 0.40% 0.00% 0.07% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 17.80% 82.00% 0.00% 0.17% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 58.70% 40.60% 0.00% 0.66% NA
Indica Intermediate  786 66.80% 32.40% 0.25% 0.51% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623234685 C -> A LOC_Os06g39130.1 upstream_gene_variant ; 3249.0bp to feature; MODIFIER silent_mutation Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N
vg0623234685 C -> A LOC_Os06g39120.1 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N
vg0623234685 C -> A LOC_Os06g39120-LOC_Os06g39130 intergenic_region ; MODIFIER silent_mutation Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N
vg0623234685 C -> DEL N N silent_mutation Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623234685 NA 7.64E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 6.97E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 7.01E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 1.97E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 3.03E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 6.17E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 2.03E-08 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 6.11E-09 4.03E-12 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 9.01E-08 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 5.79E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 4.67E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 NA 7.27E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 5.73E-06 NA mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685 2.63E-06 6.45E-12 mr1659_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251