Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623234685:

Variant ID: vg0623234685 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23234685
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGAAGGTGATGTACAGCAACATGGTCGACGCCGACGTGGCGGCGGTGAGAGGTTCCTTCCTGAGGTCTACCGCATCGACCACATCGACACCAACAGG[C/A]
AGATCCTCAACTGGTGCGACCGGCTATACCTCCAGGTCTAGCCAGAGGAGGAACGTCGGCTGGATTTCTAGCCAGAACACCTGCTAGCGCTCCGAGGACT

Reverse complement sequence

AGTCCTCGGAGCGCTAGCAGGTGTTCTGGCTAGAAATCCAGCCGACGTTCCTCCTCTGGCTAGACCTGGAGGTATAGCCGGTCGCACCAGTTGAGGATCT[G/T]
CCTGTTGGTGTCGATGTGGTCGATGCGGTAGACCTCAGGAAGGAACCTCTCACCGCCGCCACGTCGGCGTCGACCATGTTGCTGTACATCACCTTCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.50%	0.06%	0.28%	NA
All Indica	2759	58.00%	41.50%	0.07%	0.40%	NA
All Japonica	1512	99.50%	0.40%	0.00%	0.07%	NA
Aus	269	66.90%	33.10%	0.00%	0.00%	NA
Indica I	595	17.80%	82.00%	0.00%	0.17%	NA
Indica II	465	93.10%	6.90%	0.00%	0.00%	NA
Indica III	913	58.70%	40.60%	0.00%	0.66%	NA
Indica Intermediate	786	66.80%	32.40%	0.25%	0.51%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	12.20%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623234685	C -> A	LOC_Os06g39130.1	upstream_gene_variant ; 3249.0bp to feature; MODIFIER	silent_mutation	Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852	N	N	N	N
vg0623234685	C -> A	LOC_Os06g39120.1	downstream_gene_variant ; 807.0bp to feature; MODIFIER	silent_mutation	Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852	N	N	N	N
vg0623234685	C -> A	LOC_Os06g39120-LOC_Os06g39130	intergenic_region ; MODIFIER	silent_mutation	Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852	N	N	N	N
vg0623234685	C -> DEL	N	N	silent_mutation	Average:75.891; most accessible tissue: Zhenshan97 young leaf, score: 86.852	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623234685	NA	7.64E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	6.97E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	7.01E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	1.97E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	3.03E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	6.17E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	2.03E-08	NA	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	6.11E-09	4.03E-12	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	9.01E-08	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	5.79E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	4.67E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	NA	7.27E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	5.73E-06	NA	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623234685	2.63E-06	6.45E-12	mr1659_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251