Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623229182:

Variant ID: vg0623229182 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23229182
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGAAATTTAGGGCCCTCTATCGGTGAGGTAGTGGAACCTTATTAAACCACTCAGGAATGGCCGTCGATACATAAAAGTTTGCTCTTTGGGCTTAAGCC[C/T]
AAACTATTACCTCATCACTTCAGCTATCTTCTTGCACACATATCATCTCTTGTATTGTCCATATTATACCGATGAGGAGTTGTTCCTTGCATGTTCCGAT

Reverse complement sequence

ATCGGAACATGCAAGGAACAACTCCTCATCGGTATAATATGGACAATACAAGAGATGATATGTGTGCAAGAAGATAGCTGAAGTGATGAGGTAATAGTTT[G/A]
GGCTTAAGCCCAAAGAGCAAACTTTTATGTATCGACGGCCATTCCTGAGTGGTTTAATAAGGTTCCACTACCTCACCGATAGAGGGCCCTAAATTTCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.50%	0.11%	0.00%	NA
All Indica	2759	79.60%	20.30%	0.14%	0.00%	NA
All Japonica	1512	3.60%	96.40%	0.07%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	96.30%	3.50%	0.17%	0.00%	NA
Indica II	465	78.50%	21.30%	0.22%	0.00%	NA
Indica III	913	72.60%	27.30%	0.11%	0.00%	NA
Indica Intermediate	786	75.60%	24.30%	0.13%	0.00%	NA
Temperate Japonica	767	2.10%	97.80%	0.13%	0.00%	NA
Tropical Japonica	504	6.30%	93.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623229182	C -> T	LOC_Os06g39120.1	upstream_gene_variant ; 3341.0bp to feature; MODIFIER	silent_mutation	Average:57.161; most accessible tissue: Callus, score: 80.429	N	N	N	N
vg0623229182	C -> T	LOC_Os06g39110.1	downstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:57.161; most accessible tissue: Callus, score: 80.429	N	N	N	N
vg0623229182	C -> T	LOC_Os06g39110-LOC_Os06g39120	intergenic_region ; MODIFIER	silent_mutation	Average:57.161; most accessible tissue: Callus, score: 80.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623229182	NA	5.02E-43	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623229182	1.22E-06	2.98E-10	mr1526	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623229182	NA	3.63E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623229182	NA	5.39E-09	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623229182	NA	2.98E-38	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623229182	NA	2.17E-58	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251