Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623220810:

Variant ID: vg0623220810 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23220810
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGTTTCGGTTGGTATTACCAACCAGGACTAAAAATATATCTTTTGTCCCGGTTGGTAACACCAACCGGGATTAAAGATTAAAAAGCATCTTTTTTTC[C/T]
CGGTTGGTGTTACCAACCGGGACTAAAAATAGATCTTTAGTCAACCGGGACTAAAGATTAAAAAGTAGCTCTAAACTTTTGAACCAGGACTAAAGATAAT

Reverse complement sequence

ATTATCTTTAGTCCTGGTTCAAAAGTTTAGAGCTACTTTTTAATCTTTAGTCCCGGTTGACTAAAGATCTATTTTTAGTCCCGGTTGGTAACACCAACCG[G/A]
GAAAAAAAGATGCTTTTTAATCTTTAATCCCGGTTGGTGTTACCAACCGGGACAAAAGATATATTTTTAGTCCTGGTTGGTAATACCAACCGAAACAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	5.50%	6.33%	0.00%	NA
All Indica	2759	80.40%	9.30%	10.29%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	96.30%	0.40%	3.35%	0.00%	NA
Indica I	595	35.00%	34.50%	30.59%	0.00%	NA
Indica II	465	98.10%	0.40%	1.51%	0.00%	NA
Indica III	913	95.50%	0.10%	4.38%	0.00%	NA
Indica Intermediate	786	86.80%	6.20%	7.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	2.20%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623220810	C -> T	LOC_Os06g39090.1	upstream_gene_variant ; 4382.0bp to feature; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0623220810	C -> T	LOC_Os06g39100.1	downstream_gene_variant ; 2815.0bp to feature; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0623220810	C -> T	LOC_Os06g39100-LOC_Os06g39110	intergenic_region ; MODIFIER	silent_mutation	Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623220810	NA	5.01E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	3.79E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	5.25E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	1.78E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	2.38E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	7.50E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	5.58E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	3.71E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	3.69E-08	NA	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	2.14E-08	3.88E-11	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	1.60E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	2.17E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	5.55E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	3.44E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	2.41E-09	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	9.54E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	4.29E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	NA	4.80E-07	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	1.30E-06	NA	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810	4.31E-06	2.10E-11	mr1659_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251