\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623220810:

Variant ID: vg0623220810 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23220810
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTTTCGGTTGGTATTACCAACCAGGACTAAAAATATATCTTTTGTCCCGGTTGGTAACACCAACCGGGATTAAAGATTAAAAAGCATCTTTTTTTC[C/T]
CGGTTGGTGTTACCAACCGGGACTAAAAATAGATCTTTAGTCAACCGGGACTAAAGATTAAAAAGTAGCTCTAAACTTTTGAACCAGGACTAAAGATAAT

Reverse complement sequence

ATTATCTTTAGTCCTGGTTCAAAAGTTTAGAGCTACTTTTTAATCTTTAGTCCCGGTTGACTAAAGATCTATTTTTAGTCCCGGTTGGTAACACCAACCG[G/A]
GAAAAAAAGATGCTTTTTAATCTTTAATCCCGGTTGGTGTTACCAACCGGGACAAAAGATATATTTTTAGTCCTGGTTGGTAATACCAACCGAAACAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 5.50% 6.33% 0.00% NA
All Indica  2759 80.40% 9.30% 10.29% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 96.30% 0.40% 3.35% 0.00% NA
Indica I  595 35.00% 34.50% 30.59% 0.00% NA
Indica II  465 98.10% 0.40% 1.51% 0.00% NA
Indica III  913 95.50% 0.10% 4.38% 0.00% NA
Indica Intermediate  786 86.80% 6.20% 7.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 2.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623220810 C -> T LOC_Os06g39090.1 upstream_gene_variant ; 4382.0bp to feature; MODIFIER silent_mutation Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0623220810 C -> T LOC_Os06g39100.1 downstream_gene_variant ; 2815.0bp to feature; MODIFIER silent_mutation Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0623220810 C -> T LOC_Os06g39100-LOC_Os06g39110 intergenic_region ; MODIFIER silent_mutation Average:40.224; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623220810 NA 5.01E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 3.79E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 5.25E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 1.78E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 2.38E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 7.50E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 5.58E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 3.71E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 3.69E-08 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 2.14E-08 3.88E-11 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 1.60E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 2.17E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 5.55E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 3.44E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 2.41E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 9.54E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 4.29E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 NA 4.80E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 1.30E-06 NA mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623220810 4.31E-06 2.10E-11 mr1659_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251