Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623168627:

Variant ID: vg0623168627 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23168627
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCGGCGGCAAACCGGTTGGAAGCGCGAAGAGGTCGTCGAATTCCGCCAATAGGGACAGAAGGAGATCGTCAGCGTGGATCGCAGCGCATGTGGACGCG[A/G]
GGCGTTCGTCGAGGACGCCGTATAGCATGACCTCCCGGCAGCCGCGCCAAATTGCCATCCGCATGTTGACGAAGTCCCACAGTATCGGTCCAAGAGTGCG

Reverse complement sequence

CGCACTCTTGGACCGATACTGTGGGACTTCGTCAACATGCGGATGGCAATTTGGCGCGGCTGCCGGGAGGTCATGCTATACGGCGTCCTCGACGAACGCC[T/C]
CGCGTCCACATGCGCTGCGATCCACGCTGACGATCTCCTTCTGTCCCTATTGGCGGAATTCGACGACCTCTTCGCGCTTCCAACCGGTTTGCCGCCGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	41.90%	0.06%	0.21%	NA
All Indica	2759	44.90%	54.70%	0.11%	0.33%	NA
All Japonica	1512	83.20%	16.80%	0.00%	0.00%	NA
Aus	269	34.60%	65.40%	0.00%	0.00%	NA
Indica I	595	82.00%	17.80%	0.00%	0.17%	NA
Indica II	465	12.30%	87.70%	0.00%	0.00%	NA
Indica III	913	43.50%	55.80%	0.11%	0.66%	NA
Indica Intermediate	786	37.70%	61.80%	0.25%	0.25%	NA
Temperate Japonica	767	72.80%	27.20%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623168627	A -> G	LOC_Os06g39020.1	missense_variant ; p.Leu533Pro; MODERATE	nonsynonymous_codon ; L533P	Average:66.23; most accessible tissue: Zhenshan97 young leaf, score: 80.056	unknown	unknown	TOLERATED	0.10
vg0623168627	A -> DEL	LOC_Os06g39020.1	N	frameshift_variant	Average:66.23; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623168627	NA	2.33E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	5.82E-07	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	1.94E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	1.70E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	3.67E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	3.86E-07	3.85E-07	mr1466	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	8.37E-13	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	4.79E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	2.58E-11	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	4.35E-07	1.41E-10	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	2.43E-07	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	6.29E-06	mr1766	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	1.07E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	1.07E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	2.74E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	7.67E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	8.22E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627	NA	2.36E-09	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251