\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623168627:

Variant ID: vg0623168627 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23168627
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCGGCGGCAAACCGGTTGGAAGCGCGAAGAGGTCGTCGAATTCCGCCAATAGGGACAGAAGGAGATCGTCAGCGTGGATCGCAGCGCATGTGGACGCG[A/G]
GGCGTTCGTCGAGGACGCCGTATAGCATGACCTCCCGGCAGCCGCGCCAAATTGCCATCCGCATGTTGACGAAGTCCCACAGTATCGGTCCAAGAGTGCG

Reverse complement sequence

CGCACTCTTGGACCGATACTGTGGGACTTCGTCAACATGCGGATGGCAATTTGGCGCGGCTGCCGGGAGGTCATGCTATACGGCGTCCTCGACGAACGCC[T/C]
CGCGTCCACATGCGCTGCGATCCACGCTGACGATCTCCTTCTGTCCCTATTGGCGGAATTCGACGACCTCTTCGCGCTTCCAACCGGTTTGCCGCCGGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 41.90% 0.06% 0.21% NA
All Indica  2759 44.90% 54.70% 0.11% 0.33% NA
All Japonica  1512 83.20% 16.80% 0.00% 0.00% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 82.00% 17.80% 0.00% 0.17% NA
Indica II  465 12.30% 87.70% 0.00% 0.00% NA
Indica III  913 43.50% 55.80% 0.11% 0.66% NA
Indica Intermediate  786 37.70% 61.80% 0.25% 0.25% NA
Temperate Japonica  767 72.80% 27.20% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.90% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623168627 A -> G LOC_Os06g39020.1 missense_variant ; p.Leu533Pro; MODERATE nonsynonymous_codon ; L533P Average:66.23; most accessible tissue: Zhenshan97 young leaf, score: 80.056 unknown unknown TOLERATED 0.10
vg0623168627 A -> DEL LOC_Os06g39020.1 N frameshift_variant Average:66.23; most accessible tissue: Zhenshan97 young leaf, score: 80.056 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623168627 NA 2.33E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 5.82E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 1.94E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 1.70E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 3.67E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 3.86E-07 3.85E-07 mr1466 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 8.37E-13 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 4.79E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 2.58E-11 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 4.35E-07 1.41E-10 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 2.43E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 6.29E-06 mr1766 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 1.07E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 1.07E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 2.74E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 7.67E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 8.22E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623168627 NA 2.36E-09 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251