Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623150078:

Variant ID: vg0623150078 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23150078
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.17, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCGGGGATGCAAACGGACTGACTTACAAATCTAGCTTCTTATATGTCAAATAAGTGGTAACCCATGGGTTTTCGCGTCGTGGCCCTATTTACCGCACC[T/C]
AGAGATGCAAGCGGGTCGACCCATAAACTCATTTACAGGTTGAATTAGTAGGTAACCCGTGAGTCAATCTACGGGTTACCCCGCGGGTTGGCCCGCTTGC

Reverse complement sequence

GCAAGCGGGCCAACCCGCGGGGTAACCCGTAGATTGACTCACGGGTTACCTACTAATTCAACCTGTAAATGAGTTTATGGGTCGACCCGCTTGCATCTCT[A/G]
GGTGCGGTAAATAGGGCCACGACGCGAAAACCCATGGGTTACCACTTATTTGACATATAAGAAGCTAGATTTGTAAGTCAGTCCGTTTGCATCCCCGCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.30%	0.02%	0.00%	NA
All Indica	2759	94.20%	5.70%	0.04%	0.00%	NA
All Japonica	1512	3.90%	96.10%	0.00%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	91.00%	9.00%	0.00%	0.00%	NA
Indica III	913	93.40%	6.50%	0.11%	0.00%	NA
Indica Intermediate	786	93.00%	7.00%	0.00%	0.00%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623150078	T -> C	LOC_Os06g38990.1	upstream_gene_variant ; 1227.0bp to feature; MODIFIER	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0623150078	T -> C	LOC_Os06g38990-LOC_Os06g39000	intergenic_region ; MODIFIER	silent_mutation	Average:65.032; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623150078	NA	5.97E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	2.52E-30	mr1072	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	1.45E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	4.23E-41	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	9.05E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	1.23E-21	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	7.88E-32	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	2.88E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	9.69E-08	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	6.01E-39	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	2.72E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	8.30E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	7.94E-40	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	7.69E-39	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	7.06E-60	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	6.34E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	1.23E-35	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	6.45E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	5.25E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	3.20E-15	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623150078	NA	1.29E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251