\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623104065:

Variant ID: vg0623104065 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23104065
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATGGAACCGCTCTCCCCCATAGGCCCTCCGACGTGGCCAACTTGCATAAACTAGTGCGTCGACACAAGAGGACATGAATCTAGAATGAGCTTGCAC[G/A]
AGTTGTTTGGGAGGCTTCGGCAAGGGGGTTGCCTAGACAATGTCTCTAGGGAGAGAAGTGACGAAAGACCGCCGCCACCGTCCGTCAAGGTCTCAAAAAT

Reverse complement sequence

ATTTTTGAGACCTTGACGGACGGTGGCGGCGGTCTTTCGTCACTTCTCTCCCTAGAGACATTGTCTAGGCAACCCCCTTGCCGAAGCCTCCCAAACAACT[C/T]
GTGCAAGCTCATTCTAGATTCATGTCCTCTTGTGTCGACGCACTAGTTTATGCAAGTTGGCCACGTCGGAGGGCCTATGGGGGAGAGCGGTTCCATTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.10% 0.00% 0.00% NA
All Indica  2759 92.20% 7.80% 0.00% 0.00% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.30% 9.70% 0.00% 0.00% NA
Indica III  913 87.00% 13.00% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 6.50% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623104065 G -> A LOC_Os06g38940.1 upstream_gene_variant ; 2028.0bp to feature; MODIFIER silent_mutation Average:75.072; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg0623104065 G -> A LOC_Os06g38940.2 upstream_gene_variant ; 2028.0bp to feature; MODIFIER silent_mutation Average:75.072; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg0623104065 G -> A LOC_Os06g38950.1 downstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:75.072; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg0623104065 G -> A LOC_Os06g38940-LOC_Os06g38950 intergenic_region ; MODIFIER silent_mutation Average:75.072; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623104065 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623104065 NA 3.99E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.42E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 4.78E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.91E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.17E-09 mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 4.35E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 3.11E-08 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 2.58E-08 mr1438 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 2.88E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.30E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.63E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 6.17E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 4.85E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 4.27E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 1.86E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623104065 NA 8.64E-06 mr1847 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251