Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623042453:

Variant ID: vg0623042453 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23042453
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.24, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTAATCCCGGGTATTTGAACCGGGACTAAAGATAGTGATCTTTAGTCTCGGATTCTTACTGCCGGTTGGAAAACCAGGACTATAGAGGGTTACCGACC[G/A]
GGAGTAAAAAGGGTTTCTCCACCAGTGTTGGGCTGGTTTTTTACGAGCCAGATCGGGGTTGCTATTGACGTCAGGCCCATCTCAGAAACACACAAAGCGA

Reverse complement sequence

TCGCTTTGTGTGTTTCTGAGATGGGCCTGACGTCAATAGCAACCCCGATCTGGCTCGTAAAAAACCAGCCCAACACTGGTGGAGAAACCCTTTTTACTCC[C/T]
GGTCGGTAACCCTCTATAGTCCTGGTTTTCCAACCGGCAGTAAGAATCCGAGACTAAAGATCACTATCTTTAGTCCCGGTTCAAATACCCGGGATTAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 39.00% 3.00% 12.82% NA
All Indica  2759 38.10% 44.50% 1.45% 15.91% NA
All Japonica  1512 61.20% 32.50% 0.60% 5.75% NA
Aus  269 44.60% 3.30% 27.14% 24.91% NA
Indica I  595 82.40% 15.80% 0.50% 1.34% NA
Indica II  465 9.20% 78.70% 1.29% 10.75% NA
Indica III  913 29.70% 40.60% 1.86% 27.82% NA
Indica Intermediate  786 31.60% 50.50% 1.78% 16.16% NA
Temperate Japonica  767 53.30% 36.00% 0.91% 9.78% NA
Tropical Japonica  504 73.60% 25.20% 0.00% 1.19% NA
Japonica Intermediate  241 60.20% 36.50% 0.83% 2.49% NA
VI/Aromatic  96 4.20% 69.80% 18.75% 7.29% NA
Intermediate  90 36.70% 54.40% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623042453 G -> A LOC_Os06g38810.1 upstream_gene_variant ; 501.0bp to feature; MODIFIER silent_mutation Average:89.047; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0623042453 G -> A LOC_Os06g38820.1 upstream_gene_variant ; 1759.0bp to feature; MODIFIER silent_mutation Average:89.047; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0623042453 G -> A LOC_Os06g38810-LOC_Os06g38820 intergenic_region ; MODIFIER silent_mutation Average:89.047; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N
vg0623042453 G -> DEL N N silent_mutation Average:89.047; most accessible tissue: Minghui63 flag leaf, score: 94.469 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623042453 G A 0.0 -0.01 0.0 -0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623042453 NA 9.56E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623042453 NA 4.58E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623042453 NA 6.79E-09 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623042453 4.58E-06 NA mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623042453 NA 1.35E-08 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251