\
| Variant ID: vg0623040717 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 23040717 |
| Reference Allele: CCAGCTAGCTTCTCAG | Alternative Allele: GCAGCTAGCTTCTCAG,C |
| Primary Allele: CCAGCTAGCTTCTCAG | Secondary Allele: GCAGCTAGCTTCTCAG |
Inferred Ancestral Allele: Not determined.
AGTCCAGCTTTTTACCCAGATTCTGAGAATCTGTAGTTGTAGAATCTGAAAAATGAACTAGAAGCCAGAAGCTGGGTTTTCCAGCTTCTCCAGATTCTCA[CCAGCTAGCTTCTCAG/GCAGCTAGCTTCTCAG,C]
CAGCTGCTTCTCAAAATCTTAAGCTCCCCCCAAACAGGCCCTATCTTAAGCTTCTCAGCATTGTAGCGTGGGTGTGGTCCAGATTTGTTGAGCGAGATAT
ATATCTCGCTCAACAAATCTGGACCACACCCACGCTACAATGCTGAGAAGCTTAAGATAGGGCCTGTTTGGGGGGAGCTTAAGATTTTGAGAAGCAGCTG[CTGAGAAGCTAGCTGG/CTGAGAAGCTAGCTGC,G]
TGAGAATCTGGAGAAGCTGGAAAACCCAGCTTCTGGCTTCTAGTTCATTTTTCAGATTCTACAACTACAGATTCTCAGAATCTGGGTAAAAAGCTGGACT
| Populations | Population Size | Frequency of CCAGCTAGCTTCTCAG(primary allele) | Frequency of GCAGCTAGCTTCTCAG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 7.20% | 0.93% | 16.59% | C: 0.04% |
| All Indica | 2759 | 82.60% | 0.40% | 0.29% | 16.64% | C: 0.07% |
| All Japonica | 1512 | 67.00% | 21.00% | 1.12% | 10.85% | NA |
| Aus | 269 | 43.90% | 0.00% | 1.12% | 55.02% | NA |
| Indica I | 595 | 97.60% | 0.00% | 0.17% | 1.85% | C: 0.34% |
| Indica II | 465 | 86.70% | 1.70% | 0.22% | 11.40% | NA |
| Indica III | 913 | 70.60% | 0.10% | 0.33% | 28.92% | NA |
| Indica Intermediate | 786 | 82.80% | 0.10% | 0.38% | 16.67% | NA |
| Temperate Japonica | 767 | 79.70% | 4.20% | 0.78% | 15.38% | NA |
| Tropical Japonica | 504 | 43.70% | 50.40% | 0.60% | 5.36% | NA |
| Japonica Intermediate | 241 | 75.50% | 13.30% | 3.32% | 7.88% | NA |
| VI/Aromatic | 96 | 76.00% | 1.00% | 15.62% | 7.29% | NA |
| Intermediate | 90 | 82.20% | 10.00% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623040717 | CCAGCTAGCTTCTCAG -> C | LOC_Os06g38820.1 | upstream_gene_variant ; 3494.0bp to feature; MODIFIER | silent_mutation | Average:67.043; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0623040717 | CCAGCTAGCTTCTCAG -> C | LOC_Os06g38810.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.043; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0623040717 | CCAGCTAGCTTCTCAG -> GCAGCTAGCTTCTCAG | LOC_Os06g38820.1 | upstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:67.043; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0623040717 | CCAGCTAGCTTCTCAG -> GCAGCTAGCTTCTCAG | LOC_Os06g38810.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.043; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| vg0623040717 | CCAGCTAGCTTCTCAG -> DEL | N | N | silent_mutation | Average:67.043; most accessible tissue: Zhenshan97 root, score: 78.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623040717 | NA | 3.09E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 1.23E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 3.70E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 4.04E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 4.16E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 3.33E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 1.04E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 7.21E-09 | NA | mr1136_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 4.41E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 1.66E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | 4.09E-08 | 7.06E-14 | mr1408_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 9.93E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 3.61E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 1.37E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623040717 | NA | 5.90E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |