Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623036613:

Variant ID: vg0623036613 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23036613
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTTCTTTTATTTTCTTTTTTATTTTCTCCCGAATCGAGTGGCATGCACATCCCCAAATCCCCAAATCAAATAACATCCCAACTCCACATCACAAATCT[A/T]
AAAGTTACTCATACACACAAATCAAATACATCCCAAATCCTAAACAATACAAAACAAATCAAATACATCACAGATTATACATCTCAGATCTATACAAATG

Reverse complement sequence

CATTTGTATAGATCTGAGATGTATAATCTGTGATGTATTTGATTTGTTTTGTATTGTTTAGGATTTGGGATGTATTTGATTTGTGTGTATGAGTAACTTT[T/A]
AGATTTGTGATGTGGAGTTGGGATGTTATTTGATTTGGGGATTTGGGGATGTGCATGCCACTCGATTCGGGAGAAAATAAAAAAGAAAATAAAAGAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	18.30%	0.34%	17.92%	NA
All Indica	2759	80.80%	1.50%	0.11%	17.65%	NA
All Japonica	1512	35.00%	53.10%	0.46%	11.44%	NA
Aus	269	39.80%	0.70%	1.49%	57.99%	NA
Indica I	595	97.30%	0.50%	0.00%	2.18%	NA
Indica II	465	83.40%	3.90%	0.43%	12.26%	NA
Indica III	913	68.70%	1.00%	0.00%	30.34%	NA
Indica Intermediate	786	80.70%	1.40%	0.13%	17.81%	NA
Temperate Japonica	767	35.60%	47.50%	0.91%	16.04%	NA
Tropical Japonica	504	32.30%	62.30%	0.00%	5.36%	NA
Japonica Intermediate	241	38.60%	51.90%	0.00%	9.54%	NA
VI/Aromatic	96	72.90%	1.00%	2.08%	23.96%	NA
Intermediate	90	68.90%	22.20%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623036613	A -> T	LOC_Os06g38800.1	upstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0623036613	A -> T	LOC_Os06g38810.1	downstream_gene_variant ; 2594.0bp to feature; MODIFIER	silent_mutation	Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0623036613	A -> T	LOC_Os06g38800-LOC_Os06g38810	intergenic_region ; MODIFIER	silent_mutation	Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0623036613	A -> DEL	N	N	silent_mutation	Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623036613	3.45E-06	2.94E-09	mr1321_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623036613	NA	8.10E-07	mr1321_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251