\
| Variant ID: vg0623036613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 23036613 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTTTCTTTTATTTTCTTTTTTATTTTCTCCCGAATCGAGTGGCATGCACATCCCCAAATCCCCAAATCAAATAACATCCCAACTCCACATCACAAATCT[A/T]
AAAGTTACTCATACACACAAATCAAATACATCCCAAATCCTAAACAATACAAAACAAATCAAATACATCACAGATTATACATCTCAGATCTATACAAATG
CATTTGTATAGATCTGAGATGTATAATCTGTGATGTATTTGATTTGTTTTGTATTGTTTAGGATTTGGGATGTATTTGATTTGTGTGTATGAGTAACTTT[T/A]
AGATTTGTGATGTGGAGTTGGGATGTTATTTGATTTGGGGATTTGGGGATGTGCATGCCACTCGATTCGGGAGAAAATAAAAAAGAAAATAAAAGAAAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 18.30% | 0.34% | 17.92% | NA |
| All Indica | 2759 | 80.80% | 1.50% | 0.11% | 17.65% | NA |
| All Japonica | 1512 | 35.00% | 53.10% | 0.46% | 11.44% | NA |
| Aus | 269 | 39.80% | 0.70% | 1.49% | 57.99% | NA |
| Indica I | 595 | 97.30% | 0.50% | 0.00% | 2.18% | NA |
| Indica II | 465 | 83.40% | 3.90% | 0.43% | 12.26% | NA |
| Indica III | 913 | 68.70% | 1.00% | 0.00% | 30.34% | NA |
| Indica Intermediate | 786 | 80.70% | 1.40% | 0.13% | 17.81% | NA |
| Temperate Japonica | 767 | 35.60% | 47.50% | 0.91% | 16.04% | NA |
| Tropical Japonica | 504 | 32.30% | 62.30% | 0.00% | 5.36% | NA |
| Japonica Intermediate | 241 | 38.60% | 51.90% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 72.90% | 1.00% | 2.08% | 23.96% | NA |
| Intermediate | 90 | 68.90% | 22.20% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623036613 | A -> T | LOC_Os06g38800.1 | upstream_gene_variant ; 2414.0bp to feature; MODIFIER | silent_mutation | Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0623036613 | A -> T | LOC_Os06g38810.1 | downstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0623036613 | A -> T | LOC_Os06g38800-LOC_Os06g38810 | intergenic_region ; MODIFIER | silent_mutation | Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0623036613 | A -> DEL | N | N | silent_mutation | Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623036613 | 3.45E-06 | 2.94E-09 | mr1321_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623036613 | NA | 8.10E-07 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |