\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623036613:

Variant ID: vg0623036613 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23036613
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCTTTTATTTTCTTTTTTATTTTCTCCCGAATCGAGTGGCATGCACATCCCCAAATCCCCAAATCAAATAACATCCCAACTCCACATCACAAATCT[A/T]
AAAGTTACTCATACACACAAATCAAATACATCCCAAATCCTAAACAATACAAAACAAATCAAATACATCACAGATTATACATCTCAGATCTATACAAATG

Reverse complement sequence

CATTTGTATAGATCTGAGATGTATAATCTGTGATGTATTTGATTTGTTTTGTATTGTTTAGGATTTGGGATGTATTTGATTTGTGTGTATGAGTAACTTT[T/A]
AGATTTGTGATGTGGAGTTGGGATGTTATTTGATTTGGGGATTTGGGGATGTGCATGCCACTCGATTCGGGAGAAAATAAAAAAGAAAATAAAAGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 18.30% 0.34% 17.92% NA
All Indica  2759 80.80% 1.50% 0.11% 17.65% NA
All Japonica  1512 35.00% 53.10% 0.46% 11.44% NA
Aus  269 39.80% 0.70% 1.49% 57.99% NA
Indica I  595 97.30% 0.50% 0.00% 2.18% NA
Indica II  465 83.40% 3.90% 0.43% 12.26% NA
Indica III  913 68.70% 1.00% 0.00% 30.34% NA
Indica Intermediate  786 80.70% 1.40% 0.13% 17.81% NA
Temperate Japonica  767 35.60% 47.50% 0.91% 16.04% NA
Tropical Japonica  504 32.30% 62.30% 0.00% 5.36% NA
Japonica Intermediate  241 38.60% 51.90% 0.00% 9.54% NA
VI/Aromatic  96 72.90% 1.00% 2.08% 23.96% NA
Intermediate  90 68.90% 22.20% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623036613 A -> T LOC_Os06g38800.1 upstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0623036613 A -> T LOC_Os06g38810.1 downstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0623036613 A -> T LOC_Os06g38800-LOC_Os06g38810 intergenic_region ; MODIFIER silent_mutation Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0623036613 A -> DEL N N silent_mutation Average:42.398; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623036613 3.45E-06 2.94E-09 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623036613 NA 8.10E-07 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251