Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623002089:

Variant ID: vg0623002089 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23002089
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTTTTTTTTTTTTTGTCCCATGGACTTGTGCACGCACTGGCAAGAGAAAAAAGGGTATTGATAATATCACATCATTATATATCGCTGGATTGCTAGTC[G/A]
AACCGTCACTAAATACTTCTATTCTAGTTTTTTTTTAAAAAAAACTAACATAGTAAAATAACTATTCGTGTTGGTTTTTAGGAATAACTGATAAAAAAAC

Reverse complement sequence

GTTTTTTTATCAGTTATTCCTAAAAACCAACACGAATAGTTATTTTACTATGTTAGTTTTTTTTAAAAAAAAACTAGAATAGAAGTATTTAGTGACGGTT[C/T]
GACTAGCAATCCAGCGATATATAATGATGTGATATTATCAATACCCTTTTTTCTCTTGCCAGTGCGTGCACAAGTCCATGGGACAAAAAAAAAAAAACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 39.70% 0.23% 1.88% NA
All Indica  2759 41.80% 57.50% 0.36% 0.33% NA
All Japonica  1512 81.10% 13.60% 0.00% 5.29% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 82.70% 17.10% 0.00% 0.17% NA
Indica II  465 15.50% 84.30% 0.22% 0.00% NA
Indica III  913 31.90% 66.70% 0.55% 0.88% NA
Indica Intermediate  786 37.90% 61.60% 0.51% 0.00% NA
Temperate Japonica  767 73.90% 19.30% 0.00% 6.78% NA
Tropical Japonica  504 94.00% 1.80% 0.00% 4.17% NA
Japonica Intermediate  241 76.80% 20.30% 0.00% 2.90% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623002089 G -> A LOC_Os06g38740.1 upstream_gene_variant ; 2757.0bp to feature; MODIFIER silent_mutation Average:54.072; most accessible tissue: Minghui63 root, score: 94.901 N N N N
vg0623002089 G -> A LOC_Os06g38750.1 upstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:54.072; most accessible tissue: Minghui63 root, score: 94.901 N N N N
vg0623002089 G -> A LOC_Os06g38760.1 upstream_gene_variant ; 3252.0bp to feature; MODIFIER silent_mutation Average:54.072; most accessible tissue: Minghui63 root, score: 94.901 N N N N
vg0623002089 G -> A LOC_Os06g38750-LOC_Os06g38760 intergenic_region ; MODIFIER silent_mutation Average:54.072; most accessible tissue: Minghui63 root, score: 94.901 N N N N
vg0623002089 G -> DEL N N silent_mutation Average:54.072; most accessible tissue: Minghui63 root, score: 94.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623002089 G A 0.03 0.01 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623002089 NA 4.22E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 3.32E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 2.07E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 1.44E-06 8.25E-10 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 4.72E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 6.77E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 7.56E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 2.44E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 3.36E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 6.46E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 3.09E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 1.85E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 2.40E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 8.97E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 2.44E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 5.50E-07 5.30E-14 mr1659_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 4.54E-09 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 9.42E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623002089 NA 1.94E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251