Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623001816:

Variant ID: vg0623001816 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23001816
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GATATGGTTTGTCGGGGGAGGTGCTGTCCTGCGGTCAACTATCAAGTGGTTTGCTCGTGCGTCAGCCTAAAACTCAATAAATTCAGATTTCATGGCGTCA[T/C]
TCAATCTCACAAATTAGCCCCACTAGTTACGCGGTGGATCACGAGCGTTCACATCTATATTTTCAGATTATTCTTTATTTTAGAGAAAGAAATGCTTGCA

Reverse complement sequence

TGCAAGCATTTCTTTCTCTAAAATAAAGAATAATCTGAAAATATAGATGTGAACGCTCGTGATCCACCGCGTAACTAGTGGGGCTAATTTGTGAGATTGA[A/G]
TGACGCCATGAAATCTGAATTTATTGAGTTTTAGGCTGACGCACGAGCAAACCACTTGATAGTTGACCGCAGGACAGCACCTCCCCCGACAAACCATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 33.60% 0.08% 1.74% NA
All Indica  2759 93.30% 6.50% 0.14% 0.04% NA
All Japonica  1512 18.20% 76.50% 0.00% 5.36% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 97.60% 2.00% 0.17% 0.17% NA
Indica II  465 89.20% 10.80% 0.00% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.30% 0.38% 0.00% NA
Temperate Japonica  767 23.60% 69.50% 0.00% 6.91% NA
Tropical Japonica  504 6.20% 89.70% 0.00% 4.17% NA
Japonica Intermediate  241 26.10% 71.00% 0.00% 2.90% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623001816 T -> C LOC_Os06g38740.1 upstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:66.476; most accessible tissue: Zhenshan97 root, score: 98.435 N N N N
vg0623001816 T -> C LOC_Os06g38750.1 upstream_gene_variant ; 379.0bp to feature; MODIFIER silent_mutation Average:66.476; most accessible tissue: Zhenshan97 root, score: 98.435 N N N N
vg0623001816 T -> C LOC_Os06g38760.1 upstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:66.476; most accessible tissue: Zhenshan97 root, score: 98.435 N N N N
vg0623001816 T -> C LOC_Os06g38750-LOC_Os06g38760 intergenic_region ; MODIFIER silent_mutation Average:66.476; most accessible tissue: Zhenshan97 root, score: 98.435 N N N N
vg0623001816 T -> DEL N N silent_mutation Average:66.476; most accessible tissue: Zhenshan97 root, score: 98.435 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0623001816 T C 0.0 0.09 0.08 0.01 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623001816 NA 8.85E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 8.00E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 3.32E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 7.17E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 8.66E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 1.38E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 2.35E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 3.82E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 4.99E-14 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 8.38E-09 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 NA 5.32E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623001816 1.22E-07 3.40E-12 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251