\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622963063:

Variant ID: vg0622963063 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22963063
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCATACTCATACGTAAATTTCACAAAATTTTGAACCAACTAGATTTCTTTCAATATTCAGGTAGGCAAAGAAGGAAAAAAGAAACGCAGCGTACATA[C/T]
ATGTGAGAGAATTCAGTCCCACAACTTCGATTTCATGAAAATAGCATGCTACGAAGGAGTTTTCAAAAGTTACATACAAGTTACATGTAAGTTATAATAC

Reverse complement sequence

GTATTATAACTTACATGTAACTTGTATGTAACTTTTGAAAACTCCTTCGTAGCATGCTATTTTCATGAAATCGAAGTTGTGGGACTGAATTCTCTCACAT[G/A]
TATGTACGCTGCGTTTCTTTTTTCCTTCTTTGCCTACCTGAATATTGAAAGAAATCTAGTTGGTTCAAAATTTTGTGAAATTTACGTATGAGTATGAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 30.00% 0.06% 4.27% NA
All Indica  2759 52.40% 46.10% 0.11% 1.38% NA
All Japonica  1512 97.20% 1.80% 0.00% 0.99% NA
Aus  269 8.90% 37.50% 0.00% 53.53% NA
Indica I  595 19.00% 81.00% 0.00% 0.00% NA
Indica II  465 82.60% 15.30% 0.00% 2.15% NA
Indica III  913 56.60% 41.70% 0.22% 1.42% NA
Indica Intermediate  786 55.00% 43.00% 0.13% 1.91% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 92.90% 4.60% 0.00% 2.58% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 90.60% 6.20% 0.00% 3.12% NA
Intermediate  90 82.20% 15.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622963063 C -> T LOC_Os06g38670.1 missense_variant ; p.Thr1155Ile; MODERATE nonsynonymous_codon ; T1155I Average:64.413; most accessible tissue: Callus, score: 90.395 unknown unknown TOLERATED 0.17
vg0622963063 C -> DEL LOC_Os06g38670.1 N frameshift_variant Average:64.413; most accessible tissue: Callus, score: 90.395 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622963063 NA 3.58E-09 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.23E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 3.33E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 8.48E-08 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.50E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 3.42E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 2.47E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 6.15E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 3.24E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 8.05E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 3.63E-06 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 1.02E-07 9.45E-11 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 2.32E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 4.20E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.04E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.27E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 3.26E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.05E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 1.51E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 2.95E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 NA 6.15E-08 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622963063 9.14E-07 1.53E-11 mr1659_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251