Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622962887:

Variant ID: vg0622962887 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22962887
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCCATGTAAGCTGTGTCGCAGTGTAGGCCGGTCTCAAATTCTCAATTCGGAAGTGCCTAACCTTTGTGCTTTCGGCTACAATATAGTAAAATTTTGCT[A/C]
TATATTTATCGATAAATTTTCTATAAAAAATTTGATAGATATAATTATAGTGTAAGTTACATGTAACTATAATATAACTCATACTCATACGTAAATTTCA

Reverse complement sequence

TGAAATTTACGTATGAGTATGAGTTATATTATAGTTACATGTAACTTACACTATAATTATATCTATCAAATTTTTTATAGAAAATTTATCGATAAATATA[T/G]
AGCAAAATTTTACTATATTGTAGCCGAAAGCACAAAGGTTAGGCACTTCCGAATTGAGAATTTGAGACCGGCCTACACTGCGACACAGCTTACATGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	4.70%	0.02%	4.17%	NA
All Indica	2759	98.50%	0.20%	0.00%	1.30%	NA
All Japonica	1512	85.80%	13.30%	0.00%	0.93%	NA
Aus	269	42.80%	3.70%	0.37%	53.16%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.80%	0.00%	0.00%	2.15%	NA
Indica III	913	98.70%	0.00%	0.00%	1.31%	NA
Indica Intermediate	786	97.70%	0.50%	0.00%	1.78%	NA
Temperate Japonica	767	75.00%	24.90%	0.00%	0.13%	NA
Tropical Japonica	504	97.20%	0.40%	0.00%	2.38%	NA
Japonica Intermediate	241	96.30%	3.30%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	1.00%	0.00%	3.12%	NA
Intermediate	90	94.40%	4.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622962887	A -> C	LOC_Os06g38680.1	downstream_gene_variant ; 4929.0bp to feature; MODIFIER	silent_mutation	Average:92.028; most accessible tissue: Zhenshan97 panicle, score: 97.468	N	N	N	N
vg0622962887	A -> C	LOC_Os06g38670.1	intron_variant ; MODIFIER	silent_mutation	Average:92.028; most accessible tissue: Zhenshan97 panicle, score: 97.468	N	N	N	N
vg0622962887	A -> DEL	N	N	silent_mutation	Average:92.028; most accessible tissue: Zhenshan97 panicle, score: 97.468	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0622962887	A	C	0.01	0.03	0.02	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622962887	NA	3.57E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	9.17E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	1.69E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	2.29E-07	2.70E-08	mr1585	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	8.15E-10	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	1.11E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	3.77E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	8.85E-06	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	2.77E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	3.19E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	6.82E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	3.89E-06	1.15E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622962887	NA	6.06E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251