Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622958104:

Variant ID: vg0622958104 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22958104
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, C: 0.26, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAATCATAGACTAATTATACTCAAAAGATTCGTCATTCGTCTCGCGATTTTCATGTAAACTGTACAATTAGTTTTTGTTTTTATCTATATTTAATGCT[C/T]
TATACATGTGTCCAAAGATTTGATGTGACGTTTTTGGGAAAAAAAATTGGGAAGCCTGAATGAATGCATATGTTCTGCGAGTGCTCTGCTAAAAGGTTCA

Reverse complement sequence

TGAACCTTTTAGCAGAGCACTCGCAGAACATATGCATTCATTCAGGCTTCCCAATTTTTTTTCCCAAAAACGTCACATCAAATCTTTGGACACATGTATA[G/A]
AGCATTAAATATAGATAAAAACAAAAACTAATTGTACAGTTTACATGAAAATCGCGAGACGAATGACGAATCTTTTGAGTATAATTAGTCTATGATTAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.40%	9.10%	3.49%	60.94%	NA
All Indica	2759	5.00%	6.90%	5.29%	82.82%	NA
All Japonica	1512	67.60%	14.90%	0.53%	17.00%	NA
Aus	269	1.10%	4.10%	2.23%	92.57%	NA
Indica I	595	3.50%	2.00%	4.87%	89.58%	NA
Indica II	465	9.20%	9.20%	6.24%	75.27%	NA
Indica III	913	2.80%	8.90%	3.29%	84.99%	NA
Indica Intermediate	786	6.20%	6.70%	7.38%	79.64%	NA
Temperate Japonica	767	53.30%	27.50%	0.65%	18.51%	NA
Tropical Japonica	504	86.90%	1.20%	0.40%	11.51%	NA
Japonica Intermediate	241	72.60%	3.30%	0.41%	23.65%	NA
VI/Aromatic	96	45.80%	1.00%	0.00%	53.12%	NA
Intermediate	90	45.60%	6.70%	5.56%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622958104	C -> T	LOC_Os06g38660.1	upstream_gene_variant ; 788.0bp to feature; MODIFIER	silent_mutation	Average:20.527; most accessible tissue: Callus, score: 52.82	N	N	N	N
vg0622958104	C -> T	LOC_Os06g38670.1	upstream_gene_variant ; 457.0bp to feature; MODIFIER	silent_mutation	Average:20.527; most accessible tissue: Callus, score: 52.82	N	N	N	N
vg0622958104	C -> T	LOC_Os06g38650.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:20.527; most accessible tissue: Callus, score: 52.82	N	N	N	N
vg0622958104	C -> T	LOC_Os06g38660-LOC_Os06g38670	intergenic_region ; MODIFIER	silent_mutation	Average:20.527; most accessible tissue: Callus, score: 52.82	N	N	N	N
vg0622958104	C -> DEL	N	N	silent_mutation	Average:20.527; most accessible tissue: Callus, score: 52.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622958104	4.02E-06	NA	mr1158	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	7.79E-07	NA	mr1180	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	6.00E-06	NA	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	6.50E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	1.72E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	8.86E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	6.42E-06	NA	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	5.01E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	6.93E-06	6.93E-06	mr1442	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	3.61E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	7.70E-06	NA	mr1558	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	7.11E-06	NA	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	5.09E-06	7.98E-06	mr1754	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	9.39E-06	9.39E-06	mr1875	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	6.52E-06	6.51E-06	mr1996	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622958104	NA	2.99E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251