Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622937793:

Variant ID: vg0622937793 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22937793
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAGGAGGCCTTAGAGTATTAAAATTTAGCAATTTCCTATGTTTCATATTCATATTATAAAATGTTTTGGGTTTTAAATATATTAATGCATGAATCT[A/T]
TGTATGTGCTTCATATATGTGTCTAAATCTATAATTATAGATGTTAGTGAATCTAGATAAGAAATGGAGAGGCCAAAACAACTTATAATGGAATGGAAGG

Reverse complement sequence

CCTTCCATTCCATTATAAGTTGTTTTGGCCTCTCCATTTCTTATCTAGATTCACTAACATCTATAATTATAGATTTAGACACATATATGAAGCACATACA[T/A]
AGATTCATGCATTAATATATTTAAAACCCAAAACATTTTATAATATGAATATGAAACATAGGAAATTGCTAAATTTTAATACTCTAAGGCCTCCTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	8.50%	0.78%	53.30%	NA
All Indica	2759	7.50%	6.60%	1.20%	84.63%	NA
All Japonica	1512	83.30%	14.20%	0.00%	2.58%	NA
Aus	269	60.20%	0.00%	0.37%	39.41%	NA
Indica I	595	2.20%	1.00%	2.02%	94.79%	NA
Indica II	465	9.90%	7.70%	1.29%	81.08%	NA
Indica III	913	7.70%	11.50%	0.55%	80.28%	NA
Indica Intermediate	786	10.10%	4.60%	1.27%	84.10%	NA
Temperate Japonica	767	80.40%	18.40%	0.00%	1.17%	NA
Tropical Japonica	504	90.30%	4.80%	0.00%	4.96%	NA
Japonica Intermediate	241	77.60%	20.30%	0.00%	2.07%	NA
VI/Aromatic	96	92.70%	1.00%	0.00%	6.25%	NA
Intermediate	90	54.40%	5.60%	3.33%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622937793	A -> T	LOC_Os06g38640.1	upstream_gene_variant ; 1197.0bp to feature; MODIFIER	silent_mutation	Average:13.534; most accessible tissue: Callus, score: 75.129	N	N	N	N
vg0622937793	A -> T	LOC_Os06g38620-LOC_Os06g38640	intergenic_region ; MODIFIER	silent_mutation	Average:13.534; most accessible tissue: Callus, score: 75.129	N	N	N	N
vg0622937793	A -> DEL	N	N	silent_mutation	Average:13.534; most accessible tissue: Callus, score: 75.129	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622937793	NA	8.84E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	NA	1.92E-06	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	NA	1.60E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	NA	3.87E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	4.99E-06	2.20E-06	mr1768_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	NA	1.57E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793	NA	4.73E-08	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251