\
| Variant ID: vg0622937793 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22937793 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCAAAGGAGGCCTTAGAGTATTAAAATTTAGCAATTTCCTATGTTTCATATTCATATTATAAAATGTTTTGGGTTTTAAATATATTAATGCATGAATCT[A/T]
TGTATGTGCTTCATATATGTGTCTAAATCTATAATTATAGATGTTAGTGAATCTAGATAAGAAATGGAGAGGCCAAAACAACTTATAATGGAATGGAAGG
CCTTCCATTCCATTATAAGTTGTTTTGGCCTCTCCATTTCTTATCTAGATTCACTAACATCTATAATTATAGATTTAGACACATATATGAAGCACATACA[T/A]
AGATTCATGCATTAATATATTTAAAACCCAAAACATTTTATAATATGAATATGAAACATAGGAAATTGCTAAATTTTAATACTCTAAGGCCTCCTTTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.40% | 8.50% | 0.78% | 53.30% | NA |
| All Indica | 2759 | 7.50% | 6.60% | 1.20% | 84.63% | NA |
| All Japonica | 1512 | 83.30% | 14.20% | 0.00% | 2.58% | NA |
| Aus | 269 | 60.20% | 0.00% | 0.37% | 39.41% | NA |
| Indica I | 595 | 2.20% | 1.00% | 2.02% | 94.79% | NA |
| Indica II | 465 | 9.90% | 7.70% | 1.29% | 81.08% | NA |
| Indica III | 913 | 7.70% | 11.50% | 0.55% | 80.28% | NA |
| Indica Intermediate | 786 | 10.10% | 4.60% | 1.27% | 84.10% | NA |
| Temperate Japonica | 767 | 80.40% | 18.40% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 90.30% | 4.80% | 0.00% | 4.96% | NA |
| Japonica Intermediate | 241 | 77.60% | 20.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 54.40% | 5.60% | 3.33% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622937793 | A -> T | LOC_Os06g38640.1 | upstream_gene_variant ; 1197.0bp to feature; MODIFIER | silent_mutation | Average:13.534; most accessible tissue: Callus, score: 75.129 | N | N | N | N |
| vg0622937793 | A -> T | LOC_Os06g38620-LOC_Os06g38640 | intergenic_region ; MODIFIER | silent_mutation | Average:13.534; most accessible tissue: Callus, score: 75.129 | N | N | N | N |
| vg0622937793 | A -> DEL | N | N | silent_mutation | Average:13.534; most accessible tissue: Callus, score: 75.129 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622937793 | NA | 8.84E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | NA | 1.92E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | NA | 1.60E-07 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | NA | 3.87E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | 4.99E-06 | 2.20E-06 | mr1768_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | NA | 1.57E-06 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622937793 | NA | 4.73E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |