\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622937793:

Variant ID: vg0622937793 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22937793
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAGGAGGCCTTAGAGTATTAAAATTTAGCAATTTCCTATGTTTCATATTCATATTATAAAATGTTTTGGGTTTTAAATATATTAATGCATGAATCT[A/T]
TGTATGTGCTTCATATATGTGTCTAAATCTATAATTATAGATGTTAGTGAATCTAGATAAGAAATGGAGAGGCCAAAACAACTTATAATGGAATGGAAGG

Reverse complement sequence

CCTTCCATTCCATTATAAGTTGTTTTGGCCTCTCCATTTCTTATCTAGATTCACTAACATCTATAATTATAGATTTAGACACATATATGAAGCACATACA[T/A]
AGATTCATGCATTAATATATTTAAAACCCAAAACATTTTATAATATGAATATGAAACATAGGAAATTGCTAAATTTTAATACTCTAAGGCCTCCTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 8.50% 0.78% 53.30% NA
All Indica  2759 7.50% 6.60% 1.20% 84.63% NA
All Japonica  1512 83.30% 14.20% 0.00% 2.58% NA
Aus  269 60.20% 0.00% 0.37% 39.41% NA
Indica I  595 2.20% 1.00% 2.02% 94.79% NA
Indica II  465 9.90% 7.70% 1.29% 81.08% NA
Indica III  913 7.70% 11.50% 0.55% 80.28% NA
Indica Intermediate  786 10.10% 4.60% 1.27% 84.10% NA
Temperate Japonica  767 80.40% 18.40% 0.00% 1.17% NA
Tropical Japonica  504 90.30% 4.80% 0.00% 4.96% NA
Japonica Intermediate  241 77.60% 20.30% 0.00% 2.07% NA
VI/Aromatic  96 92.70% 1.00% 0.00% 6.25% NA
Intermediate  90 54.40% 5.60% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622937793 A -> T LOC_Os06g38640.1 upstream_gene_variant ; 1197.0bp to feature; MODIFIER silent_mutation Average:13.534; most accessible tissue: Callus, score: 75.129 N N N N
vg0622937793 A -> T LOC_Os06g38620-LOC_Os06g38640 intergenic_region ; MODIFIER silent_mutation Average:13.534; most accessible tissue: Callus, score: 75.129 N N N N
vg0622937793 A -> DEL N N silent_mutation Average:13.534; most accessible tissue: Callus, score: 75.129 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622937793 NA 8.84E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 NA 1.92E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 NA 1.60E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 NA 3.87E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 4.99E-06 2.20E-06 mr1768_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 NA 1.57E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622937793 NA 4.73E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251