| Variant ID: vg0622932804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22932804 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTATAAAATCAGTATATCACACGGAGTCTTCTTGGGTCCAGTGTATTCTTCTCCTAGCCGGAGTCAATGAAATGAATCAGGCTCACATGCAGAATTGGT[C/T]
GATTAAATGTTTGTCCTCGTCTGACAGGTAAATCCTGCCAAATTCTTGGCGTCAGATTTGCCAAATCTCAGGACAATGTGTGCGTTTTTATTTAAATAAT
ATTATTTAAATAAAAACGCACACATTGTCCTGAGATTTGGCAAATCTGACGCCAAGAATTTGGCAGGATTTACCTGTCAGACGAGGACAAACATTTAATC[G/A]
ACCAATTCTGCATGTGAGCCTGATTCATTTCATTGACTCCGGCTAGGAGAAGAATACACTGGACCCAAGAAGACTCCGTGTGATATACTGATTTTATAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.00% | 14.70% | 0.42% | 53.87% | NA |
| All Indica | 2759 | 4.50% | 9.40% | 0.65% | 85.47% | NA |
| All Japonica | 1512 | 82.10% | 15.30% | 0.00% | 2.58% | NA |
| Aus | 269 | 3.70% | 56.10% | 0.00% | 40.15% | NA |
| Indica I | 595 | 1.70% | 1.20% | 0.84% | 96.30% | NA |
| Indica II | 465 | 7.50% | 10.10% | 1.08% | 81.29% | NA |
| Indica III | 913 | 2.80% | 16.30% | 0.55% | 80.28% | NA |
| Indica Intermediate | 786 | 6.90% | 7.00% | 0.38% | 85.75% | NA |
| Temperate Japonica | 767 | 80.30% | 18.50% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 87.70% | 7.30% | 0.00% | 4.96% | NA |
| Japonica Intermediate | 241 | 75.90% | 22.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 46.90% | 46.90% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 51.10% | 7.80% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622932804 | C -> T | LOC_Os06g38620.1 | upstream_gene_variant ; 3221.0bp to feature; MODIFIER | silent_mutation | Average:15.427; most accessible tissue: Callus, score: 99.357 | N | N | N | N |
| vg0622932804 | C -> T | LOC_Os06g38620-LOC_Os06g38640 | intergenic_region ; MODIFIER | silent_mutation | Average:15.427; most accessible tissue: Callus, score: 99.357 | N | N | N | N |
| vg0622932804 | C -> DEL | N | N | silent_mutation | Average:15.427; most accessible tissue: Callus, score: 99.357 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622932804 | NA | 8.23E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622932804 | NA | 1.25E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622932804 | NA | 7.13E-06 | mr1438 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622932804 | 1.03E-06 | 1.47E-07 | mr1550 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622932804 | 6.62E-06 | 2.57E-06 | mr1768 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |