\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622857113:

Variant ID: vg0622857113 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22857113
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.19, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGTACGTGTGCAGTGGTTTGATTGCCTACACTATAAGAATTCTTTTTTTTGATTATGCATATCCTTGATCTCACTAAATTCATGTTAAAAGATCACC[C/T]
GTACGTGCGTAATATTATTTGAATCATGGAGCATGCATGCATCCATAAACTTCACCACAACACTACCGGCGTGCTTCCCCCATACTACCAGAATTTCGGT

Reverse complement sequence

ACCGAAATTCTGGTAGTATGGGGGAAGCACGCCGGTAGTGTTGTGGTGAAGTTTATGGATGCATGCATGCTCCATGATTCAAATAATATTACGCACGTAC[G/A]
GGTGATCTTTTAACATGAATTTAGTGAGATCAAGGATATGCATAATCAAAAAAAAGAATTCTTATAGTGTAGGCAATCAAACCACTGCACACGTACCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 24.10% 10.77% 39.82% NA
All Indica  2759 3.00% 21.10% 14.90% 61.07% NA
All Japonica  1512 68.30% 29.20% 0.99% 1.46% NA
Aus  269 0.40% 20.40% 24.54% 54.65% NA
Indica I  595 0.50% 5.50% 25.71% 68.24% NA
Indica II  465 4.50% 13.80% 16.13% 65.59% NA
Indica III  913 1.80% 39.80% 6.68% 51.81% NA
Indica Intermediate  786 5.30% 15.40% 15.52% 63.74% NA
Temperate Japonica  767 57.00% 41.30% 0.78% 0.91% NA
Tropical Japonica  504 82.70% 13.10% 1.39% 2.78% NA
Japonica Intermediate  241 74.30% 24.50% 0.83% 0.41% NA
VI/Aromatic  96 45.80% 44.80% 5.21% 4.17% NA
Intermediate  90 37.80% 22.20% 13.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622857113 C -> T LOC_Os06g38580.1 upstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N
vg0622857113 C -> T LOC_Os06g38580-LOC_Os06g38590 intergenic_region ; MODIFIER silent_mutation Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N
vg0622857113 C -> DEL N N silent_mutation Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622857113 NA 1.17E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 3.00E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 7.74E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 7.55E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 7.99E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 2.10E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 1.31E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 5.47E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 5.55E-06 mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 1.37E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 9.92E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622857113 NA 4.93E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251