\
| Variant ID: vg0622857113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22857113 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.19, others allele: 0.00, population size: 68. )
GGTGGTACGTGTGCAGTGGTTTGATTGCCTACACTATAAGAATTCTTTTTTTTGATTATGCATATCCTTGATCTCACTAAATTCATGTTAAAAGATCACC[C/T]
GTACGTGCGTAATATTATTTGAATCATGGAGCATGCATGCATCCATAAACTTCACCACAACACTACCGGCGTGCTTCCCCCATACTACCAGAATTTCGGT
ACCGAAATTCTGGTAGTATGGGGGAAGCACGCCGGTAGTGTTGTGGTGAAGTTTATGGATGCATGCATGCTCCATGATTCAAATAATATTACGCACGTAC[G/A]
GGTGATCTTTTAACATGAATTTAGTGAGATCAAGGATATGCATAATCAAAAAAAAGAATTCTTATAGTGTAGGCAATCAAACCACTGCACACGTACCACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.30% | 24.10% | 10.77% | 39.82% | NA |
| All Indica | 2759 | 3.00% | 21.10% | 14.90% | 61.07% | NA |
| All Japonica | 1512 | 68.30% | 29.20% | 0.99% | 1.46% | NA |
| Aus | 269 | 0.40% | 20.40% | 24.54% | 54.65% | NA |
| Indica I | 595 | 0.50% | 5.50% | 25.71% | 68.24% | NA |
| Indica II | 465 | 4.50% | 13.80% | 16.13% | 65.59% | NA |
| Indica III | 913 | 1.80% | 39.80% | 6.68% | 51.81% | NA |
| Indica Intermediate | 786 | 5.30% | 15.40% | 15.52% | 63.74% | NA |
| Temperate Japonica | 767 | 57.00% | 41.30% | 0.78% | 0.91% | NA |
| Tropical Japonica | 504 | 82.70% | 13.10% | 1.39% | 2.78% | NA |
| Japonica Intermediate | 241 | 74.30% | 24.50% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 45.80% | 44.80% | 5.21% | 4.17% | NA |
| Intermediate | 90 | 37.80% | 22.20% | 13.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622857113 | C -> T | LOC_Os06g38580.1 | upstream_gene_variant ; 498.0bp to feature; MODIFIER | silent_mutation | Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| vg0622857113 | C -> T | LOC_Os06g38580-LOC_Os06g38590 | intergenic_region ; MODIFIER | silent_mutation | Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| vg0622857113 | C -> DEL | N | N | silent_mutation | Average:38.758; most accessible tissue: Zhenshan97 root, score: 64.045 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622857113 | NA | 1.17E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 3.00E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 7.74E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 7.55E-08 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 7.99E-06 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 2.10E-10 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 1.31E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 5.47E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 5.55E-06 | mr1439_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 1.37E-06 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 9.92E-06 | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622857113 | NA | 4.93E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |