\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622828231:

Variant ID: vg0622828231 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22828231
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTGGGCTTGTTTCTCTTGGAGGGCAACCTCCTAGACGGATAGGTTTCGCCCGCGTGCATCCAAGTCATTGTGGATTGACCGGGGAAAGTTTGTGAAG[G/A]
TTTTCCTCGCCTCCGCAAGGAGAAGAGGTAATTTGAGTGAAAATTCCGAGCGGAGCTTTCGGAGGTTGTCTTGGTAGAGCAATCCATATTCGTGGTGTTC

Reverse complement sequence

GAACACCACGAATATGGATTGCTCTACCAAGACAACCTCCGAAAGCTCCGCTCGGAATTTTCACTCAAATTACCTCTTCTCCTTGCGGAGGCGAGGAAAA[C/T]
CTTCACAAACTTTCCCCGGTCAATCCACAATGACTTGGATGCACGCGGGCGAAACCTATCCGTCTAGGAGGTTGCCCTCCAAGAGAAACAAGCCCAAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 23.40% 0.02% 0.00% NA
All Indica  2759 96.70% 3.30% 0.00% 0.00% NA
All Japonica  1512 46.60% 53.40% 0.00% 0.00% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.40% 0.00% 0.00% NA
Temperate Japonica  767 70.40% 29.60% 0.00% 0.00% NA
Tropical Japonica  504 14.30% 85.70% 0.00% 0.00% NA
Japonica Intermediate  241 38.20% 61.80% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622828231 G -> A LOC_Os06g38510.1 downstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:43.316; most accessible tissue: Callus, score: 66.802 N N N N
vg0622828231 G -> A LOC_Os06g38520.1 downstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:43.316; most accessible tissue: Callus, score: 66.802 N N N N
vg0622828231 G -> A LOC_Os06g38510.2 downstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:43.316; most accessible tissue: Callus, score: 66.802 N N N N
vg0622828231 G -> A LOC_Os06g38520-LOC_Os06g38540 intergenic_region ; MODIFIER silent_mutation Average:43.316; most accessible tissue: Callus, score: 66.802 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622828231 NA 4.83E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 7.76E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 2.15E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 3.45E-12 mr1559 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 1.42E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 7.28E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 3.14E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 8.15E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 2.98E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 1.03E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 4.34E-11 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 8.96E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 1.02E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 1.87E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 5.29E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 2.63E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 6.81E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 5.75E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 7.88E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 3.83E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 6.69E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231 NA 1.86E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251