Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622828231:

Variant ID: vg0622828231 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22828231
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTTGGGCTTGTTTCTCTTGGAGGGCAACCTCCTAGACGGATAGGTTTCGCCCGCGTGCATCCAAGTCATTGTGGATTGACCGGGGAAAGTTTGTGAAG[G/A]
TTTTCCTCGCCTCCGCAAGGAGAAGAGGTAATTTGAGTGAAAATTCCGAGCGGAGCTTTCGGAGGTTGTCTTGGTAGAGCAATCCATATTCGTGGTGTTC

Reverse complement sequence

GAACACCACGAATATGGATTGCTCTACCAAGACAACCTCCGAAAGCTCCGCTCGGAATTTTCACTCAAATTACCTCTTCTCCTTGCGGAGGCGAGGAAAA[C/T]
CTTCACAAACTTTCCCCGGTCAATCCACAATGACTTGGATGCACGCGGGCGAAACCTATCCGTCTAGGAGGTTGCCCTCCAAGAGAAACAAGCCCAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	23.40%	0.02%	0.00%	NA
All Indica	2759	96.70%	3.30%	0.00%	0.00%	NA
All Japonica	1512	46.60%	53.40%	0.00%	0.00%	NA
Aus	269	45.70%	54.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.80%	5.20%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	6.40%	0.00%	0.00%	NA
Temperate Japonica	767	70.40%	29.60%	0.00%	0.00%	NA
Tropical Japonica	504	14.30%	85.70%	0.00%	0.00%	NA
Japonica Intermediate	241	38.20%	61.80%	0.00%	0.00%	NA
VI/Aromatic	96	56.20%	43.80%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622828231	G -> A	LOC_Os06g38510.1	downstream_gene_variant ; 4753.0bp to feature; MODIFIER	silent_mutation	Average:43.316; most accessible tissue: Callus, score: 66.802	N	N	N	N
vg0622828231	G -> A	LOC_Os06g38520.1	downstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:43.316; most accessible tissue: Callus, score: 66.802	N	N	N	N
vg0622828231	G -> A	LOC_Os06g38510.2	downstream_gene_variant ; 4753.0bp to feature; MODIFIER	silent_mutation	Average:43.316; most accessible tissue: Callus, score: 66.802	N	N	N	N
vg0622828231	G -> A	LOC_Os06g38520-LOC_Os06g38540	intergenic_region ; MODIFIER	silent_mutation	Average:43.316; most accessible tissue: Callus, score: 66.802	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622828231	NA	4.83E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	7.76E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	2.15E-11	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	3.45E-12	mr1559	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	1.42E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	7.28E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	3.14E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	8.15E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	2.98E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	1.03E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	4.34E-11	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	8.96E-07	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	1.02E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	1.87E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	5.29E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	2.63E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	6.81E-08	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	5.75E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	7.88E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	3.83E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	6.69E-11	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622828231	NA	1.86E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251