\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622823121:

Variant ID: vg0622823121 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22823121
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTGTATTAATTAAAAGCATTTTTGGAAGCGGTGGCGATGCAAATTTAGAGGGCGATAGGGCGAGGAGCATGCATGTTTGTGCGTATAGGTCTACTT[G/C]
TTGATGGTGATCACGAAAGAGCCAATGCATTGTCATGATAGAGGACATGCGCATTTATGCAGAAGGCCCTAGGGCAGGAATTATTTTTTTTTCATTGATT

Reverse complement sequence

AATCAATGAAAAAAAAATAATTCCTGCCCTAGGGCCTTCTGCATAAATGCGCATGTCCTCTATCATGACAATGCATTGGCTCTTTCGTGATCACCATCAA[C/G]
AAGTAGACCTATACGCACAAACATGCATGCTCCTCGCCCTATCGCCCTCTAAATTTGCATCGCCACCGCTTCCAAAAATGCTTTTAATTAATACAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.30% 0.13% 0.00% NA
All Indica  2759 73.10% 26.80% 0.14% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.07% 0.00% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 86.10% 13.90% 0.00% 0.00% NA
Indica II  465 79.40% 20.40% 0.22% 0.00% NA
Indica III  913 62.20% 37.60% 0.22% 0.00% NA
Indica Intermediate  786 72.10% 27.70% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622823121 G -> C LOC_Os06g38510.1 3_prime_UTR_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0622823121 G -> C LOC_Os06g38510.2 3_prime_UTR_variant ; 268.0bp to feature; MODIFIER silent_mutation Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0622823121 G -> C LOC_Os06g38520.1 upstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0622823121 G -> C LOC_Os06g38500.1 downstream_gene_variant ; 4958.0bp to feature; MODIFIER silent_mutation Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622823121 NA 2.59E-08 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 9.72E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 1.14E-10 mr1066 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 6.95E-06 2.98E-08 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 3.51E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 6.72E-06 mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 3.80E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 4.47E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 5.64E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 3.66E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 5.88E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 9.53E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 7.65E-06 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 3.60E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 1.71E-06 1.14E-07 mr1741 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 2.12E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 2.88E-07 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 4.83E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121 NA 9.79E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251