Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622823121:

Variant ID: vg0622823121 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22823121
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGTTGTATTAATTAAAAGCATTTTTGGAAGCGGTGGCGATGCAAATTTAGAGGGCGATAGGGCGAGGAGCATGCATGTTTGTGCGTATAGGTCTACTT[G/C]
TTGATGGTGATCACGAAAGAGCCAATGCATTGTCATGATAGAGGACATGCGCATTTATGCAGAAGGCCCTAGGGCAGGAATTATTTTTTTTTCATTGATT

Reverse complement sequence

AATCAATGAAAAAAAAATAATTCCTGCCCTAGGGCCTTCTGCATAAATGCGCATGTCCTCTATCATGACAATGCATTGGCTCTTTCGTGATCACCATCAA[C/G]
AAGTAGACCTATACGCACAAACATGCATGCTCCTCGCCCTATCGCCCTCTAAATTTGCATCGCCACCGCTTCCAAAAATGCTTTTAATTAATACAACTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	19.30%	0.13%	0.00%	NA
All Indica	2759	73.10%	26.80%	0.14%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.07%	0.00%	NA
Aus	269	44.20%	55.80%	0.00%	0.00%	NA
Indica I	595	86.10%	13.90%	0.00%	0.00%	NA
Indica II	465	79.40%	20.40%	0.22%	0.00%	NA
Indica III	913	62.20%	37.60%	0.22%	0.00%	NA
Indica Intermediate	786	72.10%	27.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	14.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622823121	G -> C	LOC_Os06g38510.1	3_prime_UTR_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0622823121	G -> C	LOC_Os06g38510.2	3_prime_UTR_variant ; 268.0bp to feature; MODIFIER	silent_mutation	Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0622823121	G -> C	LOC_Os06g38520.1	upstream_gene_variant ; 1555.0bp to feature; MODIFIER	silent_mutation	Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0622823121	G -> C	LOC_Os06g38500.1	downstream_gene_variant ; 4958.0bp to feature; MODIFIER	silent_mutation	Average:53.011; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622823121	NA	2.59E-08	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	9.72E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	1.14E-10	mr1066	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	6.95E-06	2.98E-08	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	3.51E-07	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	6.72E-06	mr1265	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	3.80E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	4.47E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	5.64E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	3.66E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	5.88E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	9.53E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	7.65E-06	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	3.60E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	1.71E-06	1.14E-07	mr1741	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	2.12E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	2.88E-07	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	4.83E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622823121	NA	9.79E-06	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251