\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622820572:

Variant ID: vg0622820572 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22820572
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGTATGAAATATTAAATATAGACGGAAAAATAACTAATTACACAGATCGTGTAAATTGCGAGACGAATCTTTTAAGCCTAATTGCACCATTATTTGA[C/T]
AATGTGGTGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTACATGCGGATTCTGTAATTTGTTTTGTTATT

Reverse complement sequence

AATAACAAAACAAATTACAGAATCCGCATGTAAACTGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCACCACATT[G/A]
TCAAATAATGGTGCAATTAGGCTTAAAAGATTCGTCTCGCAATTTACACGATCTGTGTAATTAGTTATTTTTCCGTCTATATTTAATATTTCATACATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 38.30% 0.83% 15.00% NA
All Indica  2759 69.50% 11.80% 0.91% 17.76% NA
All Japonica  1512 6.50% 79.60% 0.66% 13.29% NA
Aus  269 40.90% 57.20% 0.37% 1.49% NA
Indica I  595 84.90% 1.50% 0.67% 12.94% NA
Indica II  465 75.30% 13.50% 0.22% 10.97% NA
Indica III  913 59.00% 15.70% 1.42% 23.88% NA
Indica Intermediate  786 66.70% 14.10% 0.89% 18.32% NA
Temperate Japonica  767 1.60% 80.20% 0.26% 17.99% NA
Tropical Japonica  504 14.90% 82.90% 0.79% 1.39% NA
Japonica Intermediate  241 4.60% 70.50% 1.66% 23.24% NA
VI/Aromatic  96 10.40% 87.50% 1.04% 1.04% NA
Intermediate  90 37.80% 45.60% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622820572 C -> T LOC_Os06g38510.1 upstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0622820572 C -> T LOC_Os06g38520.1 upstream_gene_variant ; 4104.0bp to feature; MODIFIER silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0622820572 C -> T LOC_Os06g38510.2 upstream_gene_variant ; 545.0bp to feature; MODIFIER silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0622820572 C -> T LOC_Os06g38500.1 downstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0622820572 C -> T LOC_Os06g38500-LOC_Os06g38510 intergenic_region ; MODIFIER silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0622820572 C -> DEL N N silent_mutation Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622820572 NA 1.62E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 1.67E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 4.18E-07 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 1.08E-06 NA mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 3.44E-07 6.78E-10 mr1066 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 2.25E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 8.47E-07 8.47E-07 mr1370 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 1.26E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 2.09E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 1.70E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 1.70E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 5.35E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 4.92E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 4.45E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 5.49E-06 5.49E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572 NA 3.58E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251