Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622820572:

Variant ID: vg0622820572 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22820572
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

ACATGTATGAAATATTAAATATAGACGGAAAAATAACTAATTACACAGATCGTGTAAATTGCGAGACGAATCTTTTAAGCCTAATTGCACCATTATTTGA[C/T]
AATGTGGTGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCGCAGTTTACATGCGGATTCTGTAATTTGTTTTGTTATT

Reverse complement sequence

AATAACAAAACAAATTACAGAATCCGCATGTAAACTGCGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCACCACATT[G/A]
TCAAATAATGGTGCAATTAGGCTTAAAAGATTCGTCTCGCAATTTACACGATCTGTGTAATTAGTTATTTTTCCGTCTATATTTAATATTTCATACATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	38.30%	0.83%	15.00%	NA
All Indica	2759	69.50%	11.80%	0.91%	17.76%	NA
All Japonica	1512	6.50%	79.60%	0.66%	13.29%	NA
Aus	269	40.90%	57.20%	0.37%	1.49%	NA
Indica I	595	84.90%	1.50%	0.67%	12.94%	NA
Indica II	465	75.30%	13.50%	0.22%	10.97%	NA
Indica III	913	59.00%	15.70%	1.42%	23.88%	NA
Indica Intermediate	786	66.70%	14.10%	0.89%	18.32%	NA
Temperate Japonica	767	1.60%	80.20%	0.26%	17.99%	NA
Tropical Japonica	504	14.90%	82.90%	0.79%	1.39%	NA
Japonica Intermediate	241	4.60%	70.50%	1.66%	23.24%	NA
VI/Aromatic	96	10.40%	87.50%	1.04%	1.04%	NA
Intermediate	90	37.80%	45.60%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622820572	C -> T	LOC_Os06g38510.1	upstream_gene_variant ; 545.0bp to feature; MODIFIER	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0622820572	C -> T	LOC_Os06g38520.1	upstream_gene_variant ; 4104.0bp to feature; MODIFIER	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0622820572	C -> T	LOC_Os06g38510.2	upstream_gene_variant ; 545.0bp to feature; MODIFIER	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0622820572	C -> T	LOC_Os06g38500.1	downstream_gene_variant ; 2409.0bp to feature; MODIFIER	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0622820572	C -> T	LOC_Os06g38500-LOC_Os06g38510	intergenic_region ; MODIFIER	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N
vg0622820572	C -> DEL	N	N	silent_mutation	Average:32.223; most accessible tissue: Zhenshan97 panicle, score: 83.904	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622820572	NA	1.62E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	1.67E-06	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	4.18E-07	mr1049	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	1.08E-06	NA	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	3.44E-07	6.78E-10	mr1066	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	2.25E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	8.47E-07	8.47E-07	mr1370	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	1.26E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	2.09E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	1.70E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	1.70E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	5.35E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	4.92E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	4.45E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	5.49E-06	5.49E-06	mr1978	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622820572	NA	3.58E-06	mr1981	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251