\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622747039:

Variant ID: vg0622747039 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22747039
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATTTCTACAAAATTTTCTAGGTATATGCACCTTGGTGCACAAGGATTCCAGAAGATAAATGCTCAAGTTGTAGACCTAAGCAAAATTTGGTTTGACC[C/T]
AAATCCTTCATCTCAAATTCCGTCTTTAAATGATGACGTGCTTCATTAATATCTTGTGTATTGCCAATAATGTTGAGATCATCGACATATACCGAGATAA

Reverse complement sequence

TTATCTCGGTATATGTCGATGATCTCAACATTATTGGCAATACACAAGATATTAATGAAGCACGTCATCATTTAAAGACGGAATTTGAGATGAAGGATTT[G/A]
GGTCAAACCAAATTTTGCTTAGGTCTACAACTTGAGCATTTATCTTCTGGAATCCTTGTGCACCAAGGTGCATATACCTAGAAAATTTTGTAGAAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.00% 1.30% 11.53% 69.21% NA
All Indica  2759 10.10% 2.10% 14.32% 73.43% NA
All Japonica  1512 34.50% 0.00% 2.84% 62.70% NA
Aus  269 11.50% 1.10% 31.97% 55.39% NA
Indica I  595 14.60% 2.00% 13.11% 70.25% NA
Indica II  465 15.30% 1.70% 9.46% 73.55% NA
Indica III  913 3.70% 2.20% 19.61% 74.48% NA
Indica Intermediate  786 11.20% 2.30% 11.96% 74.55% NA
Temperate Japonica  767 58.70% 0.00% 1.04% 40.29% NA
Tropical Japonica  504 6.70% 0.00% 3.97% 89.29% NA
Japonica Intermediate  241 15.40% 0.00% 6.22% 78.42% NA
VI/Aromatic  96 2.10% 0.00% 2.08% 95.83% NA
Intermediate  90 16.70% 0.00% 21.11% 62.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622747039 C -> T LOC_Os06g38400.1 synonymous_variant ; p.Leu812Leu; LOW synonymous_codon Average:7.523; most accessible tissue: Callus, score: 33.213 N N N N
vg0622747039 C -> DEL LOC_Os06g38400.1 N frameshift_variant Average:7.523; most accessible tissue: Callus, score: 33.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622747039 NA 2.88E-06 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 4.30E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 8.23E-06 8.23E-06 mr1710 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 2.93E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 5.63E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 3.41E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 1.76E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622747039 NA 8.59E-08 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251