\
| Variant ID: vg0622747039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22747039 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAATTTCTACAAAATTTTCTAGGTATATGCACCTTGGTGCACAAGGATTCCAGAAGATAAATGCTCAAGTTGTAGACCTAAGCAAAATTTGGTTTGACC[C/T]
AAATCCTTCATCTCAAATTCCGTCTTTAAATGATGACGTGCTTCATTAATATCTTGTGTATTGCCAATAATGTTGAGATCATCGACATATACCGAGATAA
TTATCTCGGTATATGTCGATGATCTCAACATTATTGGCAATACACAAGATATTAATGAAGCACGTCATCATTTAAAGACGGAATTTGAGATGAAGGATTT[G/A]
GGTCAAACCAAATTTTGCTTAGGTCTACAACTTGAGCATTTATCTTCTGGAATCCTTGTGCACCAAGGTGCATATACCTAGAAAATTTTGTAGAAATTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 18.00% | 1.30% | 11.53% | 69.21% | NA |
| All Indica | 2759 | 10.10% | 2.10% | 14.32% | 73.43% | NA |
| All Japonica | 1512 | 34.50% | 0.00% | 2.84% | 62.70% | NA |
| Aus | 269 | 11.50% | 1.10% | 31.97% | 55.39% | NA |
| Indica I | 595 | 14.60% | 2.00% | 13.11% | 70.25% | NA |
| Indica II | 465 | 15.30% | 1.70% | 9.46% | 73.55% | NA |
| Indica III | 913 | 3.70% | 2.20% | 19.61% | 74.48% | NA |
| Indica Intermediate | 786 | 11.20% | 2.30% | 11.96% | 74.55% | NA |
| Temperate Japonica | 767 | 58.70% | 0.00% | 1.04% | 40.29% | NA |
| Tropical Japonica | 504 | 6.70% | 0.00% | 3.97% | 89.29% | NA |
| Japonica Intermediate | 241 | 15.40% | 0.00% | 6.22% | 78.42% | NA |
| VI/Aromatic | 96 | 2.10% | 0.00% | 2.08% | 95.83% | NA |
| Intermediate | 90 | 16.70% | 0.00% | 21.11% | 62.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622747039 | C -> T | LOC_Os06g38400.1 | synonymous_variant ; p.Leu812Leu; LOW | synonymous_codon | Average:7.523; most accessible tissue: Callus, score: 33.213 | N | N | N | N |
| vg0622747039 | C -> DEL | LOC_Os06g38400.1 | N | frameshift_variant | Average:7.523; most accessible tissue: Callus, score: 33.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622747039 | NA | 2.88E-06 | mr1155 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 4.30E-06 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | 8.23E-06 | 8.23E-06 | mr1710 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 2.93E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 5.63E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 3.41E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 1.76E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622747039 | NA | 8.59E-08 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |