Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622695985:

Variant ID: vg0622695985 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22695985
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATATAACTTTGTTTTAACCCATTATTAATTGCAAGCAGCTTGCTAGCCACAACAATATGACACAGTAGGATAGTACTTCCTAATTTGGTAGCAGGA[C/T]
AGAGCAAGGATGAACTAGTGATAGTTTTTTGTCCTACATCTGAACTGCGAATTCCCTTTGGAATAAACAAACGTAAAGGCTGTTCTTGGGAGAGGCAGGC

Reverse complement sequence

GCCTGCCTCTCCCAAGAACAGCCTTTACGTTTGTTTATTCCAAAGGGAATTCGCAGTTCAGATGTAGGACAAAAAACTATCACTAGTTCATCCTTGCTCT[G/A]
TCCTGCTACCAAATTAGGAAGTACTATCCTACTGTGTCATATTGTTGTGGCTAGCAAGCTGCTTGCAATTAATAATGGGTTAAAACAAAGTTATATAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.40% 0.15% 0.00% NA
All Indica  2759 97.80% 2.10% 0.11% 0.00% NA
All Japonica  1512 15.60% 84.20% 0.20% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.10% 0.25% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 38.30% 61.30% 0.40% 0.00% NA
Japonica Intermediate  241 10.80% 88.80% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622695985 C -> T LOC_Os06g38320.1 upstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:76.882; most accessible tissue: Zhenshan97 flower, score: 98.035 N N N N
vg0622695985 C -> T LOC_Os06g38320.2 upstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:76.882; most accessible tissue: Zhenshan97 flower, score: 98.035 N N N N
vg0622695985 C -> T LOC_Os06g38320.3 upstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:76.882; most accessible tissue: Zhenshan97 flower, score: 98.035 N N N N
vg0622695985 C -> T LOC_Os06g38310-LOC_Os06g38320 intergenic_region ; MODIFIER silent_mutation Average:76.882; most accessible tissue: Zhenshan97 flower, score: 98.035 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622695985 C T 0.0 0.0 -0.01 -0.05 -0.06 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622695985 NA 4.80E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0622695985 NA 9.79E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 8.15E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 2.20E-45 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 6.33E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.03E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.48E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 5.01E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.85E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 3.93E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 7.14E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.25E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 4.24E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 3.00E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 8.24E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 1.88E-07 8.17E-70 mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.52E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 4.61E-57 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 9.64E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 1.42E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 3.46E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 4.48E-44 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 7.29E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622695985 NA 8.66E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251