\
| Variant ID: vg0622678034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22678034 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAACGCATGCATACACAACTGAAGCCCATCACCCTGCTGACCTTGGTGGCATATGGTATACGCAAGTAGTTTCTTATTAAGTGGGGGACTGAATAGTTT[G/A]
GTCCGTGTACTTATATACATGCATTCTGCACGTACGTGTAGGGGGATCAATGAGGTCCCTGTAGCTCACTGTGTACATATGGCTGAGGCTGCCTGGGTGA
TCACCCAGGCAGCCTCAGCCATATGTACACAGTGAGCTACAGGGACCTCATTGATCCCCCTACACGTACGTGCAGAATGCATGTATATAAGTACACGGAC[C/T]
AAACTATTCAGTCCCCCACTTAATAAGAAACTACTTGCGTATACCATATGCCACCAAGGTCAGCAGGGTGATGGGCTTCAGTTGTGTATGCATGCGTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 18.90% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 45.80% | 53.90% | 0.26% | 0.00% | NA |
| Aus | 269 | 89.20% | 10.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 56.30% | 43.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 41.90% | 57.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 79.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622678034 | G -> A | LOC_Os06g38310.1 | downstream_gene_variant ; 3420.0bp to feature; MODIFIER | silent_mutation | Average:60.45; most accessible tissue: Callus, score: 93.365 | N | N | N | N |
| vg0622678034 | G -> A | LOC_Os06g38310-LOC_Os06g38320 | intergenic_region ; MODIFIER | silent_mutation | Average:60.45; most accessible tissue: Callus, score: 93.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622678034 | 2.32E-06 | NA | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | 1.28E-06 | NA | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 1.12E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | 2.53E-06 | NA | mr1650 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 1.81E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 3.15E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 4.59E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 1.54E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622678034 | NA | 8.08E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |