\
| Variant ID: vg0622673582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22673582 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAAGATAATAAACCAAGCTTGGCACATTAGTTCACCCTATTATCATGTAGAGTCTTCACTTACGGTGCTCTCTACTGGTAGTAGAAAGTAATATAAATCG[T/C]
TGATCTCATTTGATCGAAGGGTTCACATTTATTTATAATACCATCTTAGTTAGCGGCAATAGAAACGTGGAGGGGTATTATTGTCTGAAAAATAGGTGCG
CGCACCTATTTTTCAGACAATAATACCCCTCCACGTTTCTATTGCCGCTAACTAAGATGGTATTATAAATAAATGTGAACCCTTCGATCAAATGAGATCA[A/G]
CGATTTATATTACTTTCTACTACCAGTAGAGAGCACCGTAAGTGAAGACTCTACATGATAATAGGGTGAACTAATGTGCCAAGCTTGGTTTATTATCTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 14.30% | 0.04% | 0.51% | NA |
| All Indica | 2759 | 97.70% | 2.10% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.90% | 48.70% | 0.74% | 6.69% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.10% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 97.10% | 2.70% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622673582 | T -> C | LOC_Os06g38310.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.358; most accessible tissue: Zhenshan97 flower, score: 70.434 | N | N | N | N |
| vg0622673582 | T -> DEL | N | N | silent_mutation | Average:46.358; most accessible tissue: Zhenshan97 flower, score: 70.434 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622673582 | 6.26E-06 | 6.23E-06 | mr1340 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | 9.12E-07 | 9.08E-07 | mr1429 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 1.43E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | 2.34E-06 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 1.08E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | 4.16E-06 | 4.16E-06 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.38E-08 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.60E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.67E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.55E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 1.57E-07 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.56E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.83E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 9.74E-07 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 1.68E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.71E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.84E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.67E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.08E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.61E-06 | mr1497_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.25E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 3.83E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.95E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 1.83E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.12E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 4.52E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.18E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.80E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 2.89E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 4.26E-06 | mr1813_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 6.63E-06 | mr1814_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 5.52E-09 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | NA | 6.26E-06 | mr1894_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | 5.12E-06 | 5.11E-06 | mr1906_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673582 | 2.87E-06 | 1.40E-07 | mr1960_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |