\
| Variant ID: vg0622673581 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22673581 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAAGATAATAAACCAAGCTTGGCACATTAGTTCACCCTATTATCATGTAGAGTCTTCACTTACGGTGCTCTCTACTGGTAGTAGAAAGTAATATAAATC[G/A]
TTGATCTCATTTGATCGAAGGGTTCACATTTATTTATAATACCATCTTAGTTAGCGGCAATAGAAACGTGGAGGGGTATTATTGTCTGAAAAATAGGTGC
GCACCTATTTTTCAGACAATAATACCCCTCCACGTTTCTATTGCCGCTAACTAAGATGGTATTATAAATAAATGTGAACCCTTCGATCAAATGAGATCAA[C/T]
GATTTATATTACTTTCTACTACCAGTAGAGAGCACCGTAAGTGAAGACTCTACATGATAATAGGGTGAACTAATGTGCCAAGCTTGGTTTATTATCTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622673581 | G -> A | LOC_Os06g38310.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.772; most accessible tissue: Zhenshan97 flower, score: 71.382 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622673581 | 2.90E-06 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | 4.16E-06 | 4.16E-06 | mr1609 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 5.86E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 1.88E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 6.56E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 4.18E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 4.85E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622673581 | NA | 5.08E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |