Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622666708:

Variant ID: vg0622666708 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22666708
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAAATTCGGAATTAAAAATAAGCAATATTGAAAGAAGTTCCCATATAAGAACCTAATACGAGATTAATCAAAATTAGAAATAAAAATAAAATAAAATC[C/T]
AAAATTAGAAAAGGAAAGGAGAGTCCAAGTTGAAATACAATTTAAAAATAGCTGAAATTCGGAATTAAAAATAAGAAATATTGGAAGAAGTTTCCATATA

Reverse complement sequence

TATATGGAAACTTCTTCCAATATTTCTTATTTTTAATTCCGAATTTCAGCTATTTTTAAATTGTATTTCAACTTGGACTCTCCTTTCCTTTTCTAATTTT[G/A]
GATTTTATTTTATTTTTATTTCTAATTTTGATTAATCTCGTATTAGGTTCTTATATGGGAACTTCTTTCAATATTGCTTATTTTTAATTCCGAATTTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 16.40% 0.00% 0.00% NA
All Indica  2759 79.20% 20.80% 0.00% 0.00% NA
All Japonica  1512 88.30% 11.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 86.10% 13.90% 0.00% 0.00% NA
Indica II  465 82.80% 17.20% 0.00% 0.00% NA
Indica III  913 74.40% 25.60% 0.00% 0.00% NA
Indica Intermediate  786 77.40% 22.60% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622666708 C -> T LOC_Os06g38294.1 upstream_gene_variant ; 1619.0bp to feature; MODIFIER silent_mutation Average:19.005; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0622666708 C -> T LOC_Os06g38294-LOC_Os06g38310 intergenic_region ; MODIFIER silent_mutation Average:19.005; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622666708 NA 1.46E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 1.12E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 1.38E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 6.96E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 7.87E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 1.41E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 1.53E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 7.65E-06 NA mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 3.93E-06 NA mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 NA 5.76E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622666708 2.84E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251