Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622629240:

Variant ID: vg0622629240 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22629240
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGGGTTCACGAGATGAAGCTGTCTGACTTAACAGCGATCAAGCAGCGGTATGATGAGCCTGTACATGAGTATATTCAGAGGTTCAGAGAGATGAGGAA[T/C]
AAGTGCTTCAGCTTAAGTTTGACCGATGCCCAGTTAGCCGATTTGGCTTTCCAGGGTATGATCCCTCCGATCAGGGAGAAATTTTCATCCGAAGATTTCG

Reverse complement sequence

CGAAATCTTCGGATGAAAATTTCTCCCTGATCGGAGGGATCATACCCTGGAAAGCCAAATCGGCTAACTGGGCATCGGTCAAACTTAAGCTGAAGCACTT[A/G]
TTCCTCATCTCTCTGAACCTCTGAATATACTCATGTACAGGCTCATCATACCGCTGCTTGATCGCTGTTAAGTCAGACAGCTTCATCTCGTGAACCCCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 4.10% 1.95% 11.47% NA
All Indica  2759 86.30% 5.80% 1.23% 6.67% NA
All Japonica  1512 72.40% 1.00% 3.84% 22.82% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 92.60% 2.50% 0.67% 4.20% NA
Indica II  465 86.90% 6.20% 0.22% 6.67% NA
Indica III  913 81.50% 6.60% 1.75% 10.19% NA
Indica Intermediate  786 86.60% 7.30% 1.65% 4.45% NA
Temperate Japonica  767 82.70% 1.00% 2.87% 13.43% NA
Tropical Japonica  504 57.30% 0.60% 4.96% 37.10% NA
Japonica Intermediate  241 71.00% 1.70% 4.56% 22.82% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 76.70% 8.90% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622629240 T -> C LOC_Os06g38240.1 synonymous_variant ; p.Asn481Asn; LOW synonymous_codon Average:42.98; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0622629240 T -> DEL LOC_Os06g38240.1 N frameshift_variant Average:42.98; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622629240 8.80E-08 5.56E-09 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 6.89E-06 5.31E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 NA 1.01E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 9.95E-06 NA mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 2.49E-07 4.59E-08 mr1201_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 3.03E-07 2.33E-08 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 8.32E-06 5.82E-06 mr1219_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 NA 1.88E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 NA 1.61E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622629240 7.44E-08 2.66E-07 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251