Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622528904:

Variant ID: vg0622528904 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22528904
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CAAACAAAGCACACAAGCAAAACATGATATAAGCCTACAGAAACAGGAAACAAAACTATTTTAATGGATTCTAGGGGTTTTTATGAACTTACTGAGACTT[A/G]
AATGGACTTAAACAGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATAATCTAAGTTTTTACTATAAAAAGAAAAGGCCTTAATTATTTATTGCGCAA

Reverse complement sequence

TTGCGCAATAAATAATTAAGGCCTTTTCTTTTTATAGTAAAAACTTAGATTATCTTCTAAAAATCATAACTAATTCATCCGAGCTCTGTTTAAGTCCATT[T/C]
AAGTCTCAGTAAGTTCATAAAAACCCCTAGAATCCATTAAAATAGTTTTGTTTCCTGTTTCTGTAGGCTTATATCATGTTTTGCTTGTGTGCTTTGTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 30.60% 2.07% 6.26% NA
All Indica  2759 89.60% 2.70% 0.72% 7.03% NA
All Japonica  1512 15.90% 83.90% 0.00% 0.20% NA
Aus  269 35.30% 11.20% 24.54% 29.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 88.80% 2.20% 0.65% 8.39% NA
Indica III  913 83.20% 3.50% 1.64% 11.61% NA
Indica Intermediate  786 89.90% 3.60% 0.25% 6.23% NA
Temperate Japonica  767 2.00% 97.70% 0.00% 0.39% NA
Tropical Japonica  504 40.30% 59.70% 0.00% 0.00% NA
Japonica Intermediate  241 9.50% 90.50% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 47.90% 10.42% 18.75% NA
Intermediate  90 63.30% 31.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622528904 A -> G LOC_Os06g38080.1 downstream_gene_variant ; 2887.0bp to feature; MODIFIER silent_mutation Average:73.533; most accessible tissue: Zhenshan97 flag leaf, score: 93.925 N N N N
vg0622528904 A -> G LOC_Os06g38090.1 intron_variant ; MODIFIER silent_mutation Average:73.533; most accessible tissue: Zhenshan97 flag leaf, score: 93.925 N N N N
vg0622528904 A -> DEL N N silent_mutation Average:73.533; most accessible tissue: Zhenshan97 flag leaf, score: 93.925 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622528904 A G 0.0 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622528904 NA 8.15E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 NA 8.27E-54 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 NA 1.64E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 NA 1.16E-27 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 NA 1.28E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 7.49E-06 4.52E-74 mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622528904 NA 6.77E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251