\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622522792:

Variant ID: vg0622522792 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22522792
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CATATATTTGTTGTCATTTGACCGGCCGATCAATATACAAATAACTCCATCCCCCTCAAAAAATATATATATACAAATAACTCTACTTATTTAAAACTAT[A/G,C]
TATACTTGTATACAATATCTCTACTATGGCATTAATATTTAGTTACTTGCCAATATGTAACAACGGATTTGTTCTTGCTTGAGAACACTCCTAGATTAAT

Reverse complement sequence

ATTAATCTAGGAGTGTTCTCAAGCAAGAACAAATCCGTTGTTACATATTGGCAAGTAACTAAATATTAATGCCATAGTAGAGATATTGTATACAAGTATA[T/C,G]
ATAGTTTTAAATAAGTAGAGTTATTTGTATATATATATTTTTTGAGGGGGATGGAGTTATTTGTATATTGATCGGCCGGTCAAATGACAACAAATATATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 1.30% 1.59% 9.10% G: 0.66%
All Indica  2759 88.60% 0.00% 0.76% 9.60% G: 0.98%
All Japonica  1512 83.70% 4.00% 3.24% 8.80% G: 0.26%
Aus  269 95.90% 0.00% 1.12% 2.97% NA
Indica I  595 93.60% 0.20% 0.67% 5.55% NA
Indica II  465 85.40% 0.00% 1.29% 10.32% G: 3.01%
Indica III  913 85.90% 0.00% 0.77% 12.38% G: 0.99%
Indica Intermediate  786 89.90% 0.00% 0.51% 9.03% G: 0.51%
Temperate Japonica  767 75.00% 7.40% 5.48% 11.86% G: 0.26%
Tropical Japonica  504 96.40% 0.00% 0.00% 3.17% G: 0.40%
Japonica Intermediate  241 85.10% 1.20% 2.90% 10.79% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 87.80% 0.00% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622522792 A -> C LOC_Os06g38090.1 downstream_gene_variant ; 3895.0bp to feature; MODIFIER silent_mutation Average:51.227; most accessible tissue: Callus, score: 73.474 N N N N
vg0622522792 A -> C LOC_Os06g38080.1 intron_variant ; MODIFIER silent_mutation Average:51.227; most accessible tissue: Callus, score: 73.474 N N N N
vg0622522792 A -> G LOC_Os06g38090.1 downstream_gene_variant ; 3895.0bp to feature; MODIFIER silent_mutation Average:51.227; most accessible tissue: Callus, score: 73.474 N N N N
vg0622522792 A -> G LOC_Os06g38080.1 intron_variant ; MODIFIER silent_mutation Average:51.227; most accessible tissue: Callus, score: 73.474 N N N N
vg0622522792 A -> DEL N N silent_mutation Average:51.227; most accessible tissue: Callus, score: 73.474 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622522792 NA 1.89E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0622522792 NA 5.45E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 4.22E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 9.04E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 1.16E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 8.40E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 7.02E-07 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 8.89E-07 8.89E-07 mr1081_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 2.47E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622522792 NA 3.05E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251