\
| Variant ID: vg0622522792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22522792 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )
CATATATTTGTTGTCATTTGACCGGCCGATCAATATACAAATAACTCCATCCCCCTCAAAAAATATATATATACAAATAACTCTACTTATTTAAAACTAT[A/G,C]
TATACTTGTATACAATATCTCTACTATGGCATTAATATTTAGTTACTTGCCAATATGTAACAACGGATTTGTTCTTGCTTGAGAACACTCCTAGATTAAT
ATTAATCTAGGAGTGTTCTCAAGCAAGAACAAATCCGTTGTTACATATTGGCAAGTAACTAAATATTAATGCCATAGTAGAGATATTGTATACAAGTATA[T/C,G]
ATAGTTTTAAATAAGTAGAGTTATTTGTATATATATATTTTTTGAGGGGGATGGAGTTATTTGTATATTGATCGGCCGGTCAAATGACAACAAATATATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 1.30% | 1.59% | 9.10% | G: 0.66% |
| All Indica | 2759 | 88.60% | 0.00% | 0.76% | 9.60% | G: 0.98% |
| All Japonica | 1512 | 83.70% | 4.00% | 3.24% | 8.80% | G: 0.26% |
| Aus | 269 | 95.90% | 0.00% | 1.12% | 2.97% | NA |
| Indica I | 595 | 93.60% | 0.20% | 0.67% | 5.55% | NA |
| Indica II | 465 | 85.40% | 0.00% | 1.29% | 10.32% | G: 3.01% |
| Indica III | 913 | 85.90% | 0.00% | 0.77% | 12.38% | G: 0.99% |
| Indica Intermediate | 786 | 89.90% | 0.00% | 0.51% | 9.03% | G: 0.51% |
| Temperate Japonica | 767 | 75.00% | 7.40% | 5.48% | 11.86% | G: 0.26% |
| Tropical Japonica | 504 | 96.40% | 0.00% | 0.00% | 3.17% | G: 0.40% |
| Japonica Intermediate | 241 | 85.10% | 1.20% | 2.90% | 10.79% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 0.00% | 15.62% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622522792 | A -> C | LOC_Os06g38090.1 | downstream_gene_variant ; 3895.0bp to feature; MODIFIER | silent_mutation | Average:51.227; most accessible tissue: Callus, score: 73.474 | N | N | N | N |
| vg0622522792 | A -> C | LOC_Os06g38080.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.227; most accessible tissue: Callus, score: 73.474 | N | N | N | N |
| vg0622522792 | A -> G | LOC_Os06g38090.1 | downstream_gene_variant ; 3895.0bp to feature; MODIFIER | silent_mutation | Average:51.227; most accessible tissue: Callus, score: 73.474 | N | N | N | N |
| vg0622522792 | A -> G | LOC_Os06g38080.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.227; most accessible tissue: Callus, score: 73.474 | N | N | N | N |
| vg0622522792 | A -> DEL | N | N | silent_mutation | Average:51.227; most accessible tissue: Callus, score: 73.474 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622522792 | NA | 1.89E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0622522792 | NA | 5.45E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 4.22E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 9.04E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 1.16E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 8.40E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 7.02E-07 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | 8.89E-07 | 8.89E-07 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 2.47E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622522792 | NA | 3.05E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |