\
| Variant ID: vg0622510881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22510881 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )
GATCGCTACGTGAGTAAGGGGTGTCTTCGTTTGATAGGAGGATGCTAGGGTCAACCGTCACCGTGAAAGGGGGTTGCCCATCAAACTGATTGTAATCCTC[G/A]
TCAGTCTTGTCCTCTACTCCGATGATTTTTCTTTTGCCTGGGAGAACCACGTGGCGCTTCGGCTCGTCAGGCCCTTTGCCCTTCTTTCCTTTGCTAGACA
TGTCTAGCAAAGGAAAGAAGGGCAAAGGGCCTGACGAGCCGAAGCGCCACGTGGTTCTCCCAGGCAAAAGAAAAATCATCGGAGTAGAGGACAAGACTGA[C/T]
GAGGATTACAATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGGTTGACCCTAGCATCCTCCTATCAAACGAAGACACCCCTTACTCACGTAGCGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 38.20% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 39.20% | 60.00% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 96.30% | 2.70% | 0.99% | 0.00% | NA |
| Aus | 269 | 74.70% | 25.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 16.60% | 83.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 61.30% | 36.80% | 1.86% | 0.00% | NA |
| Indica Intermediate | 786 | 36.60% | 62.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 4.80% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622510881 | G -> A | LOC_Os06g38070.1 | synonymous_variant ; p.Asp878Asp; LOW | synonymous_codon | Average:16.349; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622510881 | 2.43E-06 | 1.10E-08 | mr1064 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 7.49E-06 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 4.49E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | 1.62E-06 | 6.54E-07 | mr1289 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 1.02E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | 4.88E-06 | 4.87E-06 | mr1329 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 9.62E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 8.75E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 6.25E-06 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 3.56E-07 | mr1534 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622510881 | NA | 3.09E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |