Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0622510569:

Variant ID: vg0622510569 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22510569
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTGTAATTAATCATATGTAACTAACATATGTAAATCCCACATGCATGATTTAAAACTTTTAAAAATTCTAATAATCGTATATAATTAACATATGCAT[G/C]
ATATTAAATTGTTAAAAATTATAACTAACATATGTAAATCCCACATGTATGATTTAAAACTTTTACAAATTCTAATAATCGTATATAATTAGCATATGCA

Reverse complement sequence

TGCATATGCTAATTATATACGATTATTAGAATTTGTAAAAGTTTTAAATCATACATGTGGGATTTACATATGTTAGTTATAATTTTTAACAATTTAATAT[C/G]
ATGCATATGTTAATTATATACGATTATTAGAATTTTTAAAAGTTTTAAATCATGCATGTGGGATTTACATATGTTAGTTACATATGATTAATTACAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.30%	0.30%	0.36%	NA
All Indica	2759	98.00%	1.80%	0.14%	0.00%	NA
All Japonica	1512	41.20%	57.30%	0.46%	1.06%	NA
Aus	269	89.20%	10.40%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	96.30%	3.30%	0.44%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	50.20%	49.50%	0.26%	0.00%	NA
Tropical Japonica	504	38.30%	57.70%	0.79%	3.17%	NA
Japonica Intermediate	241	18.70%	80.90%	0.41%	0.00%	NA
VI/Aromatic	96	54.20%	43.80%	2.08%	0.00%	NA
Intermediate	90	77.80%	21.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622510569	G -> C	LOC_Os06g38062.1	upstream_gene_variant ; 2227.0bp to feature; MODIFIER	silent_mutation	Average:12.294; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0622510569	G -> C	LOC_Os06g38070.1	downstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:12.294; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0622510569	G -> C	LOC_Os06g38062-LOC_Os06g38070	intergenic_region ; MODIFIER	silent_mutation	Average:12.294; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0622510569	G -> DEL	N	N	silent_mutation	Average:12.294; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622510569	3.29E-07	NA	mr1182	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622510569	NA	4.20E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622510569	NA	5.59E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251