Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622492754:

Variant ID: vg0622492754 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22492754
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGCAAGTTCAAATTCAACTTCTATATCTCGTAACGAAAAAACAAATTGAACCGCAGCTAGTTAACATATATTCAGAGTCAAATTTGTTTTTTTCGTTG[C/T]
GAGATGTAGAAGTTGAATTTTTACTTGTATGTTTGTGGAGTGATATATCACATATTAATACATCTTCTTAATTTTTTTCAAATTTTTTCATAACCATTTG

Reverse complement sequence

CAAATGGTTATGAAAAAATTTGAAAAAAATTAAGAAGATGTATTAATATGTGATATATCACTCCACAAACATACAAGTAAAAATTCAACTTCTACATCTC[G/A]
CAACGAAAAAAACAAATTTGACTCTGAATATATGTTAACTAGCTGCGGTTCAATTTGTTTTTTCGTTACGAGATATAGAAGTTGAATTTGAACTTGCATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.30%	21.20%	0.08%	0.34%	NA
All Indica	2759	98.20%	1.70%	0.04%	0.00%	NA
All Japonica	1512	41.90%	56.90%	0.13%	0.99%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	97.20%	2.70%	0.11%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	52.30%	47.70%	0.00%	0.00%	NA
Tropical Japonica	504	38.10%	58.90%	0.00%	2.98%	NA
Japonica Intermediate	241	17.00%	82.20%	0.83%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	75.60%	22.20%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622492754	C -> T	LOC_Os06g38040.1	upstream_gene_variant ; 619.0bp to feature; MODIFIER	silent_mutation	Average:47.28; most accessible tissue: Callus, score: 67.926	N	N	N	N
vg0622492754	C -> T	LOC_Os06g38050.1	upstream_gene_variant ; 3839.0bp to feature; MODIFIER	silent_mutation	Average:47.28; most accessible tissue: Callus, score: 67.926	N	N	N	N
vg0622492754	C -> T	LOC_Os06g38040-LOC_Os06g38050	intergenic_region ; MODIFIER	silent_mutation	Average:47.28; most accessible tissue: Callus, score: 67.926	N	N	N	N
vg0622492754	C -> DEL	N	N	silent_mutation	Average:47.28; most accessible tissue: Callus, score: 67.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622492754	4.31E-07	NA	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622492754	6.84E-06	1.70E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622492754	5.67E-08	5.67E-08	mr1465	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622492754	NA	5.05E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622492754	NA	3.68E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622492754	NA	7.49E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251