Search for Variation information by Variation ID:
Detailed information for vg0622468172:
| Variant ID: vg0622468172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22468172 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GGTTTTCAGCATAATGCGCATGGAAATGGCCACCCTCACATGGGCAACAATAGATCCAAACTGACAGACTTTCTGAGTTCTCGTCCGCCAGAGTTCTCTC[A/C]
GACCGTCGAGCCCGTCGAGGCTGACGATTGGCTGAAAGATGTTGATAGAAAACTCAACTTAGTGCAGTGTACTCCTGTTGAGAAGACGCTCTACGCCTCT
Reverse complement sequence
AGAGGCGTAGAGCGTCTTCTCAACAGGAGTACACTGCACTAAGTTGAGTTTTCTATCAACATCTTTCAGCCAATCGTCAGCCTCGACGGGCTCGACGGTC[T/G]
GAGAGAACTCTGGCGGACGAGAACTCAGAAAGTCTGTCAGTTTGGATCTATTGTTGCCCATGTGAGGGTGGCCATTTCCATGCGCATTATGCTGAAAACC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.00% | 4.60% | 5.82% | 48.56% | NA |
| All Indica | 2759 | 11.70% | 1.40% | 8.92% | 77.96% | NA |
| All Japonica | 1512 | 97.20% | 0.00% | 0.13% | 2.71% | NA |
| Aus | 269 | 17.80% | 56.10% | 2.97% | 23.05% | NA |
| Indica I | 595 | 12.90% | 0.20% | 8.24% | 78.66% | NA |
| Indica II | 465 | 16.10% | 1.30% | 10.54% | 72.04% | NA |
| Indica III | 913 | 8.20% | 2.10% | 8.00% | 81.71% | NA |
| Indica Intermediate | 786 | 12.20% | 1.70% | 9.54% | 76.59% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.13% | 1.56% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 0.20% | 4.56% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 50.00% | 28.10% | 16.67% | 5.21% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 3.33% | 40.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622468172 | A -> C | LOC_Os06g37990.1 | missense_variant ; p.Gln411Pro; MODERATE | nonsynonymous_codon ; Q411P | Average:17.961; most accessible tissue: Zhenshan97 panicle, score: 39.652 | possibly damaging  |
1.726 |
DELETERIOUS | 0.00 |
| vg0622468172 | A -> DEL | LOC_Os06g37990.1 | N | frameshift_variant | Average:17.961; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622468172 | 4.19E-07 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622468172 | 4.65E-06 | NA | mr1251_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622468172 | 9.24E-06 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622468172 | NA | 5.71E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622468172 | 4.68E-06 | NA | mr1435_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |