\
| Variant ID: vg0622463129 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22463129 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 111. )
AAATCGGCGTCTGAATCCGGCAGGGCTTCGCCCCTTCTTCTCTTCTCCTCCCCTCTCTTCTTTTTTTTTCACTGGAACTGAGGAGGGAGGAACGAGGGCT[G/A]
GGAGCTGGGCGGCAGGCCTTTTATAGGCAGCGAGGCCTGCCGCCCGGCCAGAGGGCGGCAAGGGGCCGCATGCAAAATGACCGGCCCCGACTGGCTTTTT
AAAAAGCCAGTCGGGGCCGGTCATTTTGCATGCGGCCCCTTGCCGCCCTCTGGCCGGGCGGCAGGCCTCGCTGCCTATAAAAGGCCTGCCGCCCAGCTCC[C/T]
AGCCCTCGTTCCTCCCTCCTCAGTTCCAGTGAAAAAAAAAGAAGAGAGGGGAGGAGAAGAGAAGAAGGGGCGAAGCCCTGCCGGATTCAGACGCCGATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 24.90% | 8.29% | 6.16% | NA |
| All Indica | 2759 | 37.80% | 38.70% | 13.41% | 10.08% | NA |
| All Japonica | 1512 | 97.40% | 2.00% | 0.33% | 0.33% | NA |
| Aus | 269 | 74.30% | 19.70% | 4.83% | 1.12% | NA |
| Indica I | 595 | 16.00% | 38.50% | 26.39% | 19.16% | NA |
| Indica II | 465 | 26.20% | 44.10% | 16.56% | 13.12% | NA |
| Indica III | 913 | 60.20% | 34.40% | 3.50% | 1.86% | NA |
| Indica Intermediate | 786 | 35.20% | 40.60% | 13.23% | 10.94% | NA |
| Temperate Japonica | 767 | 98.60% | 0.70% | 0.39% | 0.39% | NA |
| Tropical Japonica | 504 | 95.20% | 4.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 23.30% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622463129 | G -> A | LOC_Os06g37970.1 | upstream_gene_variant ; 502.0bp to feature; MODIFIER | silent_mutation | Average:35.311; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0622463129 | G -> A | LOC_Os06g37990.1 | upstream_gene_variant ; 3349.0bp to feature; MODIFIER | silent_mutation | Average:35.311; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0622463129 | G -> A | LOC_Os06g37980.1 | downstream_gene_variant ; 1021.0bp to feature; MODIFIER | silent_mutation | Average:35.311; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0622463129 | G -> A | LOC_Os06g37970-LOC_Os06g37980 | intergenic_region ; MODIFIER | silent_mutation | Average:35.311; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0622463129 | G -> DEL | N | N | silent_mutation | Average:35.311; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622463129 | NA | 6.77E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 2.98E-08 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 1.68E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 2.64E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 8.99E-06 | 8.99E-06 | mr1058 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.02E-08 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 2.47E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 3.86E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 9.91E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 3.21E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.26E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 9.61E-07 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 1.63E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 2.46E-06 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 7.88E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 5.03E-06 | 9.50E-06 | mr1289 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 8.25E-06 | mr1295 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 1.01E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.07E-10 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 3.10E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.18E-08 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 4.21E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 3.52E-06 | 2.26E-06 | mr1434 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 3.27E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 5.18E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 4.02E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 5.19E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 5.39E-06 | mr1600 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 4.97E-06 | mr1617 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 7.33E-06 | 3.48E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 3.38E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.17E-06 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 7.52E-06 | 9.00E-11 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | 3.87E-06 | 2.81E-08 | mr1746 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 5.29E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 9.48E-08 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 6.43E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 5.55E-06 | mr1895 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 4.56E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622463129 | NA | 2.54E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |