\
| Variant ID: vg0622416625 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22416625 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.30, others allele: 0.00, population size: 200. )
TGATCTGAACGAGCATATGCCACATGCTCTTGGGGATCATCGTCAAGGTCGATGTGAGGTCTTACATGAAGATTCTGGTTGTATTCTTCTTCATCGATGA[T/C]
GTTGTCAACTCCGACAATTCGGCGTTTGCCATCCCTCATGATGTGCATCTTCTTGTTTGAAGGGTCTTTTATGTAGAATACCTGCTCGACCTGTTTCGCA
TGCGAAACAGGTCGAGCAGGTATTCTACATAAAAGACCCTTCAAACAAGAAGATGCACATCATGAGGGATGGCAAACGCCGAATTGTCGGAGTTGACAAC[A/G]
TCATCGATGAAGAAGAATACAACCAGAATCTTCATGTAAGACCTCACATCGACCTTGACGATGATCCCCAAGAGCATGTGGCATATGCTCGTTCAGATCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 35.90% | 1.57% | 2.45% | NA |
| All Indica | 2759 | 89.20% | 4.10% | 2.61% | 4.06% | NA |
| All Japonica | 1512 | 14.70% | 85.10% | 0.07% | 0.13% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 3.20% | 1.94% | 6.67% | NA |
| Indica III | 913 | 82.00% | 6.80% | 5.70% | 5.48% | NA |
| Indica Intermediate | 786 | 90.20% | 4.50% | 1.40% | 3.94% | NA |
| Temperate Japonica | 767 | 2.00% | 97.70% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622416625 | T -> C | LOC_Os06g37860.1 | missense_variant ; p.Ile680Val; MODERATE | nonsynonymous_codon ; I680V | Average:38.673; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | benign |
0.051 |
TOLERATED | 1.00 |
| vg0622416625 | T -> DEL | LOC_Os06g37860.1 | N | frameshift_variant | Average:38.673; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622416625 | NA | 4.78E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 2.42E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 1.36E-55 | mr1125 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 4.21E-31 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 8.24E-14 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 1.40E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 3.44E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 5.04E-73 | mr1125_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 6.99E-38 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 8.12E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 9.71E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622416625 | NA | 2.47E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |