\
| Variant ID: vg0622395868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22395868 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 304. )
CCTCCTCTTTTGCTCTTCTCCGCAGACTTGTGAATTTTGGCCCAATTCGATGTGTCATTTCTGAGTTCTTGGCCCATTCATGCATAAGTCTGATTCTCGA[C/T]
ATTGTCCGATTGATTTATCGTCTGGTTTGATGTCGATTCTCCTCCATTTTATGCTTATTCTCTGCAAGATGTTAGTAACCCTAATACTAGTGGAATATTA
TAATATTCCACTAGTATTAGGGTTACTAACATCTTGCAGAGAATAAGCATAAAATGGAGGAGAATCGACATCAAACCAGACGATAAATCAATCGGACAAT[G/A]
TCGAGAATCAGACTTATGCATGAATGGGCCAAGAACTCAGAAATGACACATCGAATTGGGCCAAAATTCACAAGTCTGCGGAGAAGAGCAAAAGAGGAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 1.90% | 1.90% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 3.30% | 3.23% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 4.90% | 6.22% | 0.00% | NA |
| Indica II | 465 | 98.30% | 0.40% | 1.29% | 0.00% | NA |
| Indica III | 913 | 97.80% | 1.40% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 89.20% | 5.90% | 4.96% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622395868 | C -> T | LOC_Os06g37830.1 | downstream_gene_variant ; 4975.0bp to feature; MODIFIER | silent_mutation | Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0622395868 | C -> T | LOC_Os06g37840.1 | downstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0622395868 | C -> T | LOC_Os06g37830-LOC_Os06g37840 | intergenic_region ; MODIFIER | silent_mutation | Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622395868 | NA | 3.33E-06 | mr1049 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 5.84E-07 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 2.81E-07 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | 6.65E-06 | 6.65E-06 | mr1398 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | 4.21E-06 | 4.20E-06 | mr1459 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 2.95E-07 | mr1606 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 7.35E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 6.75E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622395868 | NA | 2.11E-07 | mr1981 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |