Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622395868:

Variant ID: vg0622395868 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22395868
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCCTCTTTTGCTCTTCTCCGCAGACTTGTGAATTTTGGCCCAATTCGATGTGTCATTTCTGAGTTCTTGGCCCATTCATGCATAAGTCTGATTCTCGA[C/T]
ATTGTCCGATTGATTTATCGTCTGGTTTGATGTCGATTCTCCTCCATTTTATGCTTATTCTCTGCAAGATGTTAGTAACCCTAATACTAGTGGAATATTA

Reverse complement sequence

TAATATTCCACTAGTATTAGGGTTACTAACATCTTGCAGAGAATAAGCATAAAATGGAGGAGAATCGACATCAAACCAGACGATAAATCAATCGGACAAT[G/A]
TCGAGAATCAGACTTATGCATGAATGGGCCAAGAACTCAGAAATGACACATCGAATTGGGCCAAAATTCACAAGTCTGCGGAGAAGAGCAAAAGAGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	1.90%	1.90%	0.00%	NA
All Indica	2759	93.50%	3.30%	3.23%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.90%	4.90%	6.22%	0.00%	NA
Indica II	465	98.30%	0.40%	1.29%	0.00%	NA
Indica III	913	97.80%	1.40%	0.77%	0.00%	NA
Indica Intermediate	786	89.20%	5.90%	4.96%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622395868	C -> T	LOC_Os06g37830.1	downstream_gene_variant ; 4975.0bp to feature; MODIFIER	silent_mutation	Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0622395868	C -> T	LOC_Os06g37840.1	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0622395868	C -> T	LOC_Os06g37830-LOC_Os06g37840	intergenic_region ; MODIFIER	silent_mutation	Average:48.414; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622395868	NA	3.33E-06	mr1049	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	5.84E-07	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	2.81E-07	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	6.65E-06	6.65E-06	mr1398	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	4.21E-06	4.20E-06	mr1459	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	2.95E-07	mr1606	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	7.35E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	6.75E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622395868	NA	2.11E-07	mr1981	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251