\
| Variant ID: vg0622384184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22384184 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 107. )
TCTTGATTATATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGAATTTCTATTATTTTCCTTAATTGTATTTCTATATG[G/A]
ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATGTATATTATTTCCTAATTTTATTTTTATATGGTCTCTATACTCTACTTATAATATT
AATATTATAAGTAGAGTATAGAGACCATATAAAAATAAAATTAGGAAATAATATACATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT[C/T]
CATATAGAAATACAATTAAGGAAAATAATAGAAATTCGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATATAATCAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 44.00% | 5.25% | 0.13% | NA |
| All Indica | 2759 | 20.80% | 70.50% | 8.55% | 0.22% | NA |
| All Japonica | 1512 | 97.40% | 2.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 75.10% | 24.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 1.70% | 86.90% | 11.26% | 0.17% | NA |
| Indica II | 465 | 20.20% | 64.30% | 14.62% | 0.86% | NA |
| Indica III | 913 | 36.60% | 61.40% | 1.97% | 0.00% | NA |
| Indica Intermediate | 786 | 17.20% | 72.10% | 10.56% | 0.13% | NA |
| Temperate Japonica | 767 | 98.60% | 1.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 32.20% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622384184 | G -> A | LOC_Os06g37830.1 | upstream_gene_variant ; 4183.0bp to feature; MODIFIER | silent_mutation | Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0622384184 | G -> A | LOC_Os06g37820.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0622384184 | G -> DEL | N | N | silent_mutation | Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622384184 | NA | 1.45E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622384184 | NA | 6.33E-06 | mr1604_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622384184 | NA | 4.36E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622384184 | NA | 8.62E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622384184 | NA | 9.87E-06 | mr1824_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622384184 | NA | 6.29E-06 | mr1921_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |