Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622384184:

Variant ID: vg0622384184 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22384184
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTGATTATATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGAATTTCTATTATTTTCCTTAATTGTATTTCTATATG[G/A]
ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATGTATATTATTTCCTAATTTTATTTTTATATGGTCTCTATACTCTACTTATAATATT

Reverse complement sequence

AATATTATAAGTAGAGTATAGAGACCATATAAAAATAAAATTAGGAAATAATATACATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT[C/T]
CATATAGAAATACAATTAAGGAAAATAATAGAAATTCGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATATAATCAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	44.00%	5.25%	0.13%	NA
All Indica	2759	20.80%	70.50%	8.55%	0.22%	NA
All Japonica	1512	97.40%	2.40%	0.20%	0.00%	NA
Aus	269	75.10%	24.20%	0.74%	0.00%	NA
Indica I	595	1.70%	86.90%	11.26%	0.17%	NA
Indica II	465	20.20%	64.30%	14.62%	0.86%	NA
Indica III	913	36.60%	61.40%	1.97%	0.00%	NA
Indica Intermediate	786	17.20%	72.10%	10.56%	0.13%	NA
Temperate Japonica	767	98.60%	1.20%	0.26%	0.00%	NA
Tropical Japonica	504	95.00%	4.80%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	60.00%	32.20%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622384184	G -> A	LOC_Os06g37830.1	upstream_gene_variant ; 4183.0bp to feature; MODIFIER	silent_mutation	Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0622384184	G -> A	LOC_Os06g37820.1	intron_variant ; MODIFIER	silent_mutation	Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0622384184	G -> DEL	N	N	silent_mutation	Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622384184	NA	1.45E-12	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184	NA	6.33E-06	mr1604_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184	NA	4.36E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184	NA	8.62E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184	NA	9.87E-06	mr1824_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184	NA	6.29E-06	mr1921_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251