\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622384184:

Variant ID: vg0622384184 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22384184
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGATTATATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGAATTTCTATTATTTTCCTTAATTGTATTTCTATATG[G/A]
ACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCCGAATGTATATTATTTCCTAATTTTATTTTTATATGGTCTCTATACTCTACTTATAATATT

Reverse complement sequence

AATATTATAAGTAGAGTATAGAGACCATATAAAAATAAAATTAGGAAATAATATACATTCGGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGT[C/T]
CATATAGAAATACAATTAAGGAAAATAATAGAAATTCGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATATAATCAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 44.00% 5.25% 0.13% NA
All Indica  2759 20.80% 70.50% 8.55% 0.22% NA
All Japonica  1512 97.40% 2.40% 0.20% 0.00% NA
Aus  269 75.10% 24.20% 0.74% 0.00% NA
Indica I  595 1.70% 86.90% 11.26% 0.17% NA
Indica II  465 20.20% 64.30% 14.62% 0.86% NA
Indica III  913 36.60% 61.40% 1.97% 0.00% NA
Indica Intermediate  786 17.20% 72.10% 10.56% 0.13% NA
Temperate Japonica  767 98.60% 1.20% 0.26% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 60.00% 32.20% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622384184 G -> A LOC_Os06g37830.1 upstream_gene_variant ; 4183.0bp to feature; MODIFIER silent_mutation Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0622384184 G -> A LOC_Os06g37820.1 intron_variant ; MODIFIER silent_mutation Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0622384184 G -> DEL N N silent_mutation Average:18.344; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622384184 NA 1.45E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184 NA 6.33E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184 NA 4.36E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184 NA 8.62E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184 NA 9.87E-06 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622384184 NA 6.29E-06 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251