\
| Variant ID: vg0622322008 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22322008 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 304. )
GAAGACTAGGGCGACGACCACAGGCACTTGACGGCAGGCACGAGCTAGACACCAACGCCATCATCCTCCAGGAACTCCTCTTCTAGGTTGGGGAAAAAAT[G/A]
AGCAAGATTGAGTACAACCACCGTACTCAGCAAGACACACCCACAATTGCAGAATAAATGTGAAGGAGTATAAGGGGGTTATAATATAGGGGTTAGGATT
AATCCTAACCCCTATATTATAACCCCCTTATACTCCTTCACATTTATTCTGCAATTGTGGGTGTGTCTTGCTGAGTACGGTGGTTGTACTCAATCTTGCT[C/T]
ATTTTTTCCCCAACCTAGAAGAGGAGTTCCTGGAGGATGATGGCGTTGGTGTCTAGCTCGTGCCTGCCGTCAAGTGCCTGTGGTCGTCGCCCTAGTCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 27.00% | 2.14% | 0.00% | NA |
| All Indica | 2759 | 51.70% | 45.00% | 3.33% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 16.80% | 76.80% | 6.39% | 0.00% | NA |
| Indica II | 465 | 35.70% | 59.80% | 4.52% | 0.00% | NA |
| Indica III | 913 | 83.50% | 15.70% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 50.60% | 46.20% | 3.18% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 22.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622322008 | G -> A | LOC_Os06g37670.1 | downstream_gene_variant ; 2991.0bp to feature; MODIFIER | silent_mutation | Average:64.297; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0622322008 | G -> A | LOC_Os06g37670-LOC_Os06g37680 | intergenic_region ; MODIFIER | silent_mutation | Average:64.297; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622322008 | NA | 8.15E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 8.61E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 2.51E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 4.18E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 3.73E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 6.09E-30 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 1.37E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | 1.59E-06 | 1.21E-07 | mr1887 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 2.92E-11 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 1.24E-07 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 1.28E-07 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 3.22E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 1.40E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622322008 | NA | 1.01E-07 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |