\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622289909:

Variant ID: vg0622289909 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22289909
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAATTATAGTTTTTTGAGACAAAGCCTGAGAGCATAGTTGCAGTTTATATGGGACGGAGGTAATAATAGGTTTCACGTTTTACGTACGATAACTTACT[C/T]
TTTATTTTCATCGGTTTCAAACACCACATTACTAGTGCCAATGCATGCTAGCTGCTTCTTTTTTTAAAAAAAAAACAACTACATGCTGCTTTTCTGCGTG

Reverse complement sequence

CACGCAGAAAAGCAGCATGTAGTTGTTTTTTTTTTAAAAAAAGAAGCAGCTAGCATGCATTGGCACTAGTAATGTGGTGTTTGAAACCGATGAAAATAAA[G/A]
AGTAAGTTATCGTACGTAAAACGTGAAACCTATTATTACCTCCGTCCCATATAAACTGCAACTATGCTCTCAGGCTTTGTCTCAAAAAACTATAATTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.40% 0.02% 0.00% NA
All Indica  2759 88.20% 11.70% 0.04% 0.00% NA
All Japonica  1512 15.00% 85.00% 0.00% 0.00% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 80.90% 18.90% 0.11% 0.00% NA
Indica Intermediate  786 88.90% 11.10% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 36.90% 63.10% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 90.00% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622289909 C -> T LOC_Os06g37630.1 upstream_gene_variant ; 3415.0bp to feature; MODIFIER silent_mutation Average:70.05; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0622289909 C -> T LOC_Os06g37640.1 downstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:70.05; most accessible tissue: Minghui63 root, score: 86.064 N N N N
vg0622289909 C -> T LOC_Os06g37630-LOC_Os06g37640 intergenic_region ; MODIFIER silent_mutation Average:70.05; most accessible tissue: Minghui63 root, score: 86.064 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622289909 C T -0.04 -0.01 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622289909 NA 1.67E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 1.66E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 3.75E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 5.61E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 2.61E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 3.69E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 2.16E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 1.88E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 4.23E-06 2.17E-07 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 3.27E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622289909 NA 2.47E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251