Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622253727:

Variant ID: vg0622253727 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22253727
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TATATATTGCATGTATTTTATTTTTTAGATCTTTACATTGCAAAAAAATTATCACCAACCCATCTACTAAAAGTTACAGTGTAATTTTACTATAGTTACA[G/C]
TGTAACTACACTATAGTTACACTGTAACTATAGTGTAATTACGTATAGTTGCACTGTAATTATAGTGTAATTACATGTAGTAACACTATAACTATAGTGT

Reverse complement sequence

ACACTATAGTTATAGTGTTACTACATGTAATTACACTATAATTACAGTGCAACTATACGTAATTACACTATAGTTACAGTGTAACTATAGTGTAGTTACA[C/G]
TGTAACTATAGTAAAATTACACTGTAACTTTTAGTAGATGGGTTGGTGATAATTTTTTTGCAATGTAAAGATCTAAAAAATAAAATACATGCAATATATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.70%	3.40%	3.75%	61.13%	NA
All Indica	2759	4.00%	1.70%	3.01%	91.34%	NA
All Japonica	1512	86.40%	0.10%	0.93%	12.57%	NA
Aus	269	16.00%	39.00%	8.92%	36.06%	NA
Indica I	595	0.80%	0.20%	1.34%	97.65%	NA
Indica II	465	4.90%	1.30%	2.37%	91.40%	NA
Indica III	913	3.50%	1.80%	4.38%	90.36%	NA
Indica Intermediate	786	6.20%	3.10%	3.05%	87.66%	NA
Temperate Japonica	767	94.80%	0.00%	0.13%	5.08%	NA
Tropical Japonica	504	72.20%	0.40%	1.39%	25.99%	NA
Japonica Intermediate	241	89.20%	0.00%	2.49%	8.30%	NA
VI/Aromatic	96	18.80%	4.20%	45.83%	31.25%	NA
Intermediate	90	26.70%	2.20%	13.33%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622253727	G -> C	LOC_Os06g37570.1	upstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N
vg0622253727	G -> C	LOC_Os06g37560.1	downstream_gene_variant ; 1955.0bp to feature; MODIFIER	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N
vg0622253727	G -> C	LOC_Os06g37580.1	downstream_gene_variant ; 2926.0bp to feature; MODIFIER	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N
vg0622253727	G -> C	LOC_Os06g37590.1	downstream_gene_variant ; 4334.0bp to feature; MODIFIER	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N
vg0622253727	G -> C	LOC_Os06g37560-LOC_Os06g37570	intergenic_region ; MODIFIER	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N
vg0622253727	G -> DEL	N	N	silent_mutation	Average:18.659; most accessible tissue: Callus, score: 56.379	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622253727	NA	3.72E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	1.21E-55	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	5.74E-18	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	3.43E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	8.60E-11	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	2.51E-28	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	2.19E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	3.20E-14	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	1.92E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	1.45E-17	mr1333_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	4.62E-06	mr1439_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	3.26E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	2.25E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	1.08E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	3.47E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727	NA	4.87E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251