\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622253727:

Variant ID: vg0622253727 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22253727
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATTGCATGTATTTTATTTTTTAGATCTTTACATTGCAAAAAAATTATCACCAACCCATCTACTAAAAGTTACAGTGTAATTTTACTATAGTTACA[G/C]
TGTAACTACACTATAGTTACACTGTAACTATAGTGTAATTACGTATAGTTGCACTGTAATTATAGTGTAATTACATGTAGTAACACTATAACTATAGTGT

Reverse complement sequence

ACACTATAGTTATAGTGTTACTACATGTAATTACACTATAATTACAGTGCAACTATACGTAATTACACTATAGTTACAGTGTAACTATAGTGTAGTTACA[C/G]
TGTAACTATAGTAAAATTACACTGTAACTTTTAGTAGATGGGTTGGTGATAATTTTTTTGCAATGTAAAGATCTAAAAAATAAAATACATGCAATATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.70% 3.40% 3.75% 61.13% NA
All Indica  2759 4.00% 1.70% 3.01% 91.34% NA
All Japonica  1512 86.40% 0.10% 0.93% 12.57% NA
Aus  269 16.00% 39.00% 8.92% 36.06% NA
Indica I  595 0.80% 0.20% 1.34% 97.65% NA
Indica II  465 4.90% 1.30% 2.37% 91.40% NA
Indica III  913 3.50% 1.80% 4.38% 90.36% NA
Indica Intermediate  786 6.20% 3.10% 3.05% 87.66% NA
Temperate Japonica  767 94.80% 0.00% 0.13% 5.08% NA
Tropical Japonica  504 72.20% 0.40% 1.39% 25.99% NA
Japonica Intermediate  241 89.20% 0.00% 2.49% 8.30% NA
VI/Aromatic  96 18.80% 4.20% 45.83% 31.25% NA
Intermediate  90 26.70% 2.20% 13.33% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622253727 G -> C LOC_Os06g37570.1 upstream_gene_variant ; 627.0bp to feature; MODIFIER silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N
vg0622253727 G -> C LOC_Os06g37560.1 downstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N
vg0622253727 G -> C LOC_Os06g37580.1 downstream_gene_variant ; 2926.0bp to feature; MODIFIER silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N
vg0622253727 G -> C LOC_Os06g37590.1 downstream_gene_variant ; 4334.0bp to feature; MODIFIER silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N
vg0622253727 G -> C LOC_Os06g37560-LOC_Os06g37570 intergenic_region ; MODIFIER silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N
vg0622253727 G -> DEL N N silent_mutation Average:18.659; most accessible tissue: Callus, score: 56.379 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622253727 NA 3.72E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 1.21E-55 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 5.74E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 3.43E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 8.60E-11 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 2.51E-28 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 2.19E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 3.20E-14 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 1.92E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 1.45E-17 mr1333_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 4.62E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 3.26E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 2.25E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 1.08E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 3.47E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622253727 NA 4.87E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251