\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622250564:

Variant ID: vg0622250564 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22250564
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGTAGTTAATATGATGGGATTTGCTTCGGTCCAATAAAAAGTATGTCGAGGTACCAGTACCTTACGGTACTAAATTGTTTCCGATTATTAGGTCTAA[C/T]
AATGTCCATCCTACTTAACTAGATCCAATGATCAGAAACTAATATGATAGAAAAAATACATATGATTTATTAGATTAGAAGAAATGTATAAACTGATATC

Reverse complement sequence

GATATCAGTTTATACATTTCTTCTAATCTAATAAATCATATGTATTTTTTCTATCATATTAGTTTCTGATCATTGGATCTAGTTAAGTAGGATGGACATT[G/A]
TTAGACCTAATAATCGGAAACAATTTAGTACCGTAAGGTACTGGTACCTCGACATACTTTTTATTGGACCGAAGCAAATCCCATCATATTAACTACTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 46.80% 0.28% 1.74% NA
All Indica  2759 24.60% 74.30% 0.40% 0.69% NA
All Japonica  1512 96.80% 2.90% 0.00% 0.26% NA
Aus  269 74.30% 25.70% 0.00% 0.00% NA
Indica I  595 13.90% 84.90% 1.18% 0.00% NA
Indica II  465 20.60% 79.40% 0.00% 0.00% NA
Indica III  913 26.10% 72.00% 0.00% 1.97% NA
Indica Intermediate  786 33.50% 65.90% 0.51% 0.13% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 2.50% 0.00% 1.66% NA
VI/Aromatic  96 34.40% 9.40% 1.04% 55.21% NA
Intermediate  90 44.40% 47.80% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622250564 C -> T LOC_Os06g37570.1 upstream_gene_variant ; 3790.0bp to feature; MODIFIER silent_mutation Average:90.404; most accessible tissue: Zhenshan97 flower, score: 95.948 N N N N
vg0622250564 C -> T LOC_Os06g37560.1 intron_variant ; MODIFIER silent_mutation Average:90.404; most accessible tissue: Zhenshan97 flower, score: 95.948 N N N N
vg0622250564 C -> DEL N N silent_mutation Average:90.404; most accessible tissue: Zhenshan97 flower, score: 95.948 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622250564 C T 0.0 0.02 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622250564 NA 4.38E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 2.64E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 5.16E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 9.72E-09 mr1237 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 3.28E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 7.12E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 3.86E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622250564 NA 5.75E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251