Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0622249479:

Variant ID: vg0622249479 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22249479
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATATTTTCATGTACACATATAGTTTTACATATTTTATAAATTTTTTTAATAAGACGAATA[A/G]
TCAAACACGTGTTAAAAAGTCAACAGTGTCAAACATTTTAGAACGGAGGGAGTACTATAAGTAACTTAAAGTACTAAAAAATTTTAGTGTAAAATTTTGG

Reverse complement sequence

CCAAAATTTTACACTAAAATTTTTTAGTACTTTAAGTTACTTATAGTACTCCCTCCGTTCTAAAATGTTTGACACTGTTGACTTTTTAACACGTGTTTGA[T/C]
TATTCGTCTTATTAAAAAAATTTATAAAATATGTAAAACTATATGTGTACATGAAAATATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	32.00%	0.59%	1.74%	NA
All Indica	2759	92.50%	6.60%	0.29%	0.69%	NA
All Japonica	1512	17.20%	82.50%	0.07%	0.26%	NA
Aus	269	72.10%	23.00%	4.83%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	85.90%	11.80%	0.33%	1.97%	NA
Indica Intermediate	786	92.60%	6.70%	0.51%	0.13%	NA
Temperate Japonica	767	6.50%	93.50%	0.00%	0.00%	NA
Tropical Japonica	504	35.70%	64.10%	0.20%	0.00%	NA
Japonica Intermediate	241	12.40%	85.90%	0.00%	1.66%	NA
VI/Aromatic	96	37.50%	5.20%	3.12%	54.17%	NA
Intermediate	90	68.90%	20.00%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622249479	A -> G	LOC_Os06g37570.1	upstream_gene_variant ; 4875.0bp to feature; MODIFIER	silent_mutation	Average:58.41; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg0622249479	A -> G	LOC_Os06g37560.1	intron_variant ; MODIFIER	silent_mutation	Average:58.41; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N
vg0622249479	A -> DEL	N	N	silent_mutation	Average:58.41; most accessible tissue: Zhenshan97 flower, score: 68.734	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622249479	NA	1.22E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622249479	1.70E-06	1.70E-06	mr1012	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622249479	NA	3.59E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622249479	NA	7.24E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251