\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621856200:

Variant ID: vg0621856200 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21856200
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTCTGTAGATTTTTCCACATCGTTATGAATTCTGTAGATTCCGAGACGAATCGTATTGTAAGATTCAAACAACTTTGCATAAGAAAACAGCACAAAA[T/C]
TGTATAGTTATCAATCTCCATTTTTATTAATCTGGCATTAAACATGTACATGCTGCAAAATGTTCTGCTCATTCAGGTATAACTTAGCAAGTAGAAACAA

Reverse complement sequence

TTGTTTCTACTTGCTAAGTTATACCTGAATGAGCAGAACATTTTGCAGCATGTACATGTTTAATGCCAGATTAATAAAAATGGAGATTGATAACTATACA[A/G]
TTTTGTGCTGTTTTCTTATGCAAAGTTGTTTGAATCTTACAATACGATTCGTCTCGGAATCTACAGAATTCATAACGATGTGGAAAAATCTACAGAATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 2.40% 13.69% 8.55% NA
All Indica  2759 79.30% 0.80% 14.14% 5.80% NA
All Japonica  1512 80.90% 5.70% 8.13% 5.29% NA
Aus  269 6.70% 0.00% 36.43% 56.88% NA
Indica I  595 96.00% 0.00% 1.51% 2.52% NA
Indica II  465 83.90% 1.10% 10.54% 4.52% NA
Indica III  913 67.80% 0.00% 26.83% 5.37% NA
Indica Intermediate  786 77.40% 2.00% 11.07% 9.54% NA
Temperate Japonica  767 91.10% 0.30% 2.87% 5.74% NA
Tropical Japonica  504 61.70% 15.10% 17.26% 5.95% NA
Japonica Intermediate  241 88.40% 3.30% 5.81% 2.49% NA
VI/Aromatic  96 70.80% 0.00% 27.08% 2.08% NA
Intermediate  90 71.10% 7.80% 11.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621856200 T -> C LOC_Os06g37030.1 upstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:20.806; most accessible tissue: Callus, score: 42.937 N N N N
vg0621856200 T -> C LOC_Os06g37030-LOC_Os06g37040 intergenic_region ; MODIFIER silent_mutation Average:20.806; most accessible tissue: Callus, score: 42.937 N N N N
vg0621856200 T -> DEL N N silent_mutation Average:20.806; most accessible tissue: Callus, score: 42.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621856200 NA 7.20E-09 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621856200 NA 1.02E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621856200 NA 1.89E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621856200 NA 2.57E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621856200 NA 2.75E-10 mr1136_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621856200 NA 2.01E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251