\
| Variant ID: vg0621856200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21856200 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGATTCTGTAGATTTTTCCACATCGTTATGAATTCTGTAGATTCCGAGACGAATCGTATTGTAAGATTCAAACAACTTTGCATAAGAAAACAGCACAAAA[T/C]
TGTATAGTTATCAATCTCCATTTTTATTAATCTGGCATTAAACATGTACATGCTGCAAAATGTTCTGCTCATTCAGGTATAACTTAGCAAGTAGAAACAA
TTGTTTCTACTTGCTAAGTTATACCTGAATGAGCAGAACATTTTGCAGCATGTACATGTTTAATGCCAGATTAATAAAAATGGAGATTGATAACTATACA[A/G]
TTTTGTGCTGTTTTCTTATGCAAAGTTGTTTGAATCTTACAATACGATTCGTCTCGGAATCTACAGAATTCATAACGATGTGGAAAAATCTACAGAATCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 2.40% | 13.69% | 8.55% | NA |
| All Indica | 2759 | 79.30% | 0.80% | 14.14% | 5.80% | NA |
| All Japonica | 1512 | 80.90% | 5.70% | 8.13% | 5.29% | NA |
| Aus | 269 | 6.70% | 0.00% | 36.43% | 56.88% | NA |
| Indica I | 595 | 96.00% | 0.00% | 1.51% | 2.52% | NA |
| Indica II | 465 | 83.90% | 1.10% | 10.54% | 4.52% | NA |
| Indica III | 913 | 67.80% | 0.00% | 26.83% | 5.37% | NA |
| Indica Intermediate | 786 | 77.40% | 2.00% | 11.07% | 9.54% | NA |
| Temperate Japonica | 767 | 91.10% | 0.30% | 2.87% | 5.74% | NA |
| Tropical Japonica | 504 | 61.70% | 15.10% | 17.26% | 5.95% | NA |
| Japonica Intermediate | 241 | 88.40% | 3.30% | 5.81% | 2.49% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 27.08% | 2.08% | NA |
| Intermediate | 90 | 71.10% | 7.80% | 11.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621856200 | T -> C | LOC_Os06g37030.1 | upstream_gene_variant ; 3185.0bp to feature; MODIFIER | silent_mutation | Average:20.806; most accessible tissue: Callus, score: 42.937 | N | N | N | N |
| vg0621856200 | T -> C | LOC_Os06g37030-LOC_Os06g37040 | intergenic_region ; MODIFIER | silent_mutation | Average:20.806; most accessible tissue: Callus, score: 42.937 | N | N | N | N |
| vg0621856200 | T -> DEL | N | N | silent_mutation | Average:20.806; most accessible tissue: Callus, score: 42.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621856200 | NA | 7.20E-09 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621856200 | NA | 1.02E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621856200 | NA | 1.89E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621856200 | NA | 2.57E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621856200 | NA | 2.75E-10 | mr1136_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621856200 | NA | 2.01E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |