\
| Variant ID: vg0621838550 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21838550 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 241. )
GCATGTTGCGTACTTAGCCAGTATAGTCGTGACAACTGTAGATTAATTCCTGATAGAAATGACAATTTTTCTCTATAATCCTACTTCTGCAAAAAAATTT[A/T]
AAAAAAACACACAACACTTAAAAAGTTATATTCTTCCGTACAATCCTCACAAAATTAACAACCCCAAAATATATATAAAAAGAGAACATCTACTGGCAGT
ACTGCCAGTAGATGTTCTCTTTTTATATATATTTTGGGGTTGTTAATTTTGTGAGGATTGTACGGAAGAATATAACTTTTTAAGTGTTGTGTGTTTTTTT[T/A]
AAATTTTTTTGCAGAAGTAGGATTATAGAGAAAAATTGTCATTTCTATCAGGAATTAATCTACAGTTGTCACGACTATACTGGCTAAGTACGCAACATGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 4.50% | 6.81% | 0.00% | NA |
| All Indica | 2759 | 83.30% | 7.10% | 9.60% | 0.00% | NA |
| All Japonica | 1512 | 96.50% | 0.20% | 3.31% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.40% | 20.80% | 27.73% | 0.00% | NA |
| Indica II | 465 | 92.50% | 0.60% | 6.88% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 5.90% | 8.40% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 0.00% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.80% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 13.50% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621838550 | A -> T | LOC_Os06g37020.1 | upstream_gene_variant ; 2636.0bp to feature; MODIFIER | silent_mutation | Average:47.515; most accessible tissue: Callus, score: 81.709 | N | N | N | N |
| vg0621838550 | A -> T | LOC_Os06g37010-LOC_Os06g37020 | intergenic_region ; MODIFIER | silent_mutation | Average:47.515; most accessible tissue: Callus, score: 81.709 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621838550 | NA | 5.75E-06 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | NA | 1.45E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | NA | 4.23E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | 3.16E-06 | 9.09E-06 | mr1445_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | NA | 9.16E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | NA | 9.90E-07 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | 3.28E-06 | 3.28E-06 | mr1651_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | 7.95E-06 | 7.30E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | 1.56E-06 | 1.62E-10 | mr1864_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621838550 | 1.85E-06 | 1.17E-07 | mr1970_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |