\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621838550:

Variant ID: vg0621838550 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21838550
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GCATGTTGCGTACTTAGCCAGTATAGTCGTGACAACTGTAGATTAATTCCTGATAGAAATGACAATTTTTCTCTATAATCCTACTTCTGCAAAAAAATTT[A/T]
AAAAAAACACACAACACTTAAAAAGTTATATTCTTCCGTACAATCCTCACAAAATTAACAACCCCAAAATATATATAAAAAGAGAACATCTACTGGCAGT

Reverse complement sequence

ACTGCCAGTAGATGTTCTCTTTTTATATATATTTTGGGGTTGTTAATTTTGTGAGGATTGTACGGAAGAATATAACTTTTTAAGTGTTGTGTGTTTTTTT[T/A]
AAATTTTTTTGCAGAAGTAGGATTATAGAGAAAAATTGTCATTTCTATCAGGAATTAATCTACAGTTGTCACGACTATACTGGCTAAGTACGCAACATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 4.50% 6.81% 0.00% NA
All Indica  2759 83.30% 7.10% 9.60% 0.00% NA
All Japonica  1512 96.50% 0.20% 3.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 51.40% 20.80% 27.73% 0.00% NA
Indica II  465 92.50% 0.60% 6.88% 0.00% NA
Indica III  913 97.30% 2.50% 0.22% 0.00% NA
Indica Intermediate  786 85.80% 5.90% 8.40% 0.00% NA
Temperate Japonica  767 95.20% 0.00% 4.82% 0.00% NA
Tropical Japonica  504 98.80% 0.20% 0.99% 0.00% NA
Japonica Intermediate  241 95.90% 0.80% 3.32% 0.00% NA
VI/Aromatic  96 83.30% 13.50% 3.12% 0.00% NA
Intermediate  90 92.20% 3.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621838550 A -> T LOC_Os06g37020.1 upstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:47.515; most accessible tissue: Callus, score: 81.709 N N N N
vg0621838550 A -> T LOC_Os06g37010-LOC_Os06g37020 intergenic_region ; MODIFIER silent_mutation Average:47.515; most accessible tissue: Callus, score: 81.709 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621838550 NA 5.75E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 NA 1.45E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 NA 4.23E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 3.16E-06 9.09E-06 mr1445_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 NA 9.16E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 NA 9.90E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 3.28E-06 3.28E-06 mr1651_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 7.95E-06 7.30E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 1.56E-06 1.62E-10 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621838550 1.85E-06 1.17E-07 mr1970_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251