\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621761253:

Variant ID: vg0621761253 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21761253
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTTAGAAGCTTCCAAAGAAAAAAAAATCCCACGCCTCCAAACGCCCAAAATGCATCTCCCCTCGCCTTCCTCTAGTACCTTCCAGAATGTTCCGTTTC[C/T]
CTCCTATAAATTACAAAATCCCACCTTCTTCTCCCGCCAAAAGCACGCCGATGGACTACTCGACGGTGAAGCAGGAGGAGGTGGAGGTGGTGGTGCTGGA

Reverse complement sequence

TCCAGCACCACCACCTCCACCTCCTCCTGCTTCACCGTCGAGTAGTCCATCGGCGTGCTTTTGGCGGGAGAAGAAGGTGGGATTTTGTAATTTATAGGAG[G/A]
GAAACGGAACATTCTGGAAGGTACTAGAGGAAGGCGAGGGGAGATGCATTTTGGGCGTTTGGAGGCGTGGGATTTTTTTTTCTTTGGAAGCTTCTAACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 4.00% 18.85% 6.73% NA
All Indica  2759 78.70% 0.60% 17.76% 2.90% NA
All Japonica  1512 66.10% 11.30% 13.76% 8.80% NA
Aus  269 6.70% 0.00% 59.48% 33.83% NA
Indica I  595 83.50% 0.00% 15.13% 1.34% NA
Indica II  465 79.80% 0.60% 16.56% 3.01% NA
Indica III  913 74.40% 0.10% 21.91% 3.61% NA
Indica Intermediate  786 79.50% 1.70% 15.65% 3.18% NA
Temperate Japonica  767 76.40% 3.40% 8.47% 11.73% NA
Tropical Japonica  504 58.30% 13.90% 21.23% 6.55% NA
Japonica Intermediate  241 49.80% 31.10% 14.94% 4.15% NA
VI/Aromatic  96 70.80% 0.00% 17.71% 11.46% NA
Intermediate  90 75.60% 3.30% 17.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621761253 C -> T LOC_Os06g36920.1 upstream_gene_variant ; 2689.0bp to feature; MODIFIER silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N
vg0621761253 C -> T LOC_Os06g36930.1 upstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N
vg0621761253 C -> T LOC_Os06g36940.1 downstream_gene_variant ; 1865.0bp to feature; MODIFIER silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N
vg0621761253 C -> T LOC_Os06g36950.1 downstream_gene_variant ; 4561.0bp to feature; MODIFIER silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N
vg0621761253 C -> T LOC_Os06g36920-LOC_Os06g36930 intergenic_region ; MODIFIER silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N
vg0621761253 C -> DEL N N silent_mutation Average:92.589; most accessible tissue: Zhenshan97 root, score: 97.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0621761253 C T -0.02 -0.04 -0.05 -0.03 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621761253 NA 1.20E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 2.85E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 1.41E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 8.27E-07 NA mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 8.86E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 5.46E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 1.37E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 3.88E-06 NA mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 7.10E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 2.92E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 7.41E-08 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 6.10E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 6.09E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621761253 NA 7.10E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251