\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0621728622:

Variant ID: vg0621728622 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 21728622
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGGCCGCCCGAACGCAAGGTCGGTGAGAGGCCCCGCCATCATCGTCCTTGCGGCCGCACGGCTTTGCCGGTAACCGCTCGGGCGACAGCGAGGCGGA[A/G]
GAGGAAGGAGGGGGAGAGGGGGCGGCTAGGTCATCGCCTCCCAAGCCGCCCATGGGGAGGGCGACGCGAGAGTAGGAGTGCTAGTTCTTATAAAAGAACA

Reverse complement sequence

TGTTCTTTTATAAGAACTAGCACTCCTACTCTCGCGTCGCCCTCCCCATGGGCGGCTTGGGAGGCGATGACCTAGCCGCCCCCTCTCCCCCTCCTTCCTC[T/C]
TCCGCCTCGCTGTCGCCCGAGCGGTTACCGGCAAAGCCGTGCGGCCGCAAGGACGATGATGGCGGGGCCTCTCACCGACCTTGCGTTCGGGCGGCCAGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 24.70% 1.46% 6.37% NA
All Indica  2759 68.30% 25.40% 0.69% 5.58% NA
All Japonica  1512 81.30% 6.10% 3.04% 9.59% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 94.30% 5.00% 0.50% 0.17% NA
Indica II  465 78.10% 20.00% 1.51% 0.43% NA
Indica III  913 45.60% 43.50% 0.88% 10.08% NA
Indica Intermediate  786 69.30% 23.00% 0.13% 7.51% NA
Temperate Japonica  767 81.70% 0.40% 1.43% 16.43% NA
Tropical Japonica  504 77.60% 14.90% 6.15% 1.39% NA
Japonica Intermediate  241 87.60% 5.80% 1.66% 4.98% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 67.80% 25.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0621728622 A -> G LOC_Os06g36870.1 upstream_gene_variant ; 3232.0bp to feature; MODIFIER silent_mutation Average:77.203; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0621728622 A -> G LOC_Os06g36880.1 downstream_gene_variant ; 1780.0bp to feature; MODIFIER silent_mutation Average:77.203; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0621728622 A -> G LOC_Os06g36870-LOC_Os06g36880 intergenic_region ; MODIFIER silent_mutation Average:77.203; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0621728622 A -> DEL N N silent_mutation Average:77.203; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0621728622 3.37E-07 NA mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 6.21E-07 3.95E-06 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 3.28E-06 NA mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 5.17E-06 NA mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 8.37E-07 NA mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 8.17E-07 5.00E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 5.53E-06 NA mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 1.75E-07 2.43E-06 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 NA 8.35E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 2.47E-07 7.41E-07 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 5.11E-07 3.67E-06 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 7.18E-07 2.02E-06 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 3.09E-06 4.12E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 3.87E-06 5.24E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 6.23E-06 NA mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 NA 9.50E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 NA 4.64E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 2.58E-07 1.95E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 7.31E-06 4.07E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 4.08E-06 5.98E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621728622 9.70E-06 3.20E-06 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251